Incidental Mutation 'R5548:Slc10a5'
List |< first << previous [record 31 of 45] next >> last >|
ID434972
Institutional Source Beutler Lab
Gene Symbol Slc10a5
Ensembl Gene ENSMUSG00000058921
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 5
SynonymsLOC241877
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location10331734-10335656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10334317 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 428 (Y428N)
Ref Sequence ENSEMBL: ENSMUSP00000077808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065938] [ENSMUST00000078748] [ENSMUST00000118410] [ENSMUST00000128912] [ENSMUST00000191670] [ENSMUST00000192603]
Predicted Effect probably benign
Transcript: ENSMUST00000065938
SMART Domains Protein: ENSMUSP00000068174
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 1.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078748
AA Change: Y428N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077808
Gene: ENSMUSG00000058921
AA Change: Y428N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SBF 144 328 1.1e-34 PFAM
transmembrane domain 336 358 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118410
SMART Domains Protein: ENSMUSP00000113860
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 7.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128912
SMART Domains Protein: ENSMUSP00000116088
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 19 90 4.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191670
SMART Domains Protein: ENSMUSP00000141345
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 180 4.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192603
SMART Domains Protein: ENSMUSP00000141735
Gene: ENSMUSG00000103392

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Slc10a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Slc10a5 APN 3 10335309 missense probably benign 0.05
IGL01785:Slc10a5 APN 3 10335199 missense probably benign 0.00
IGL01823:Slc10a5 APN 3 10334514 missense possibly damaging 0.93
IGL01915:Slc10a5 APN 3 10335520 missense probably damaging 0.98
IGL02522:Slc10a5 APN 3 10335121 missense probably benign 0.09
IGL02721:Slc10a5 APN 3 10334535 missense probably benign 0.01
PIT4382001:Slc10a5 UTSW 3 10335447 missense probably benign
R0558:Slc10a5 UTSW 3 10335117 missense probably damaging 1.00
R0961:Slc10a5 UTSW 3 10334424 missense probably benign 0.00
R1747:Slc10a5 UTSW 3 10335391 missense probably benign 0.04
R1889:Slc10a5 UTSW 3 10335490 missense probably benign 0.33
R2130:Slc10a5 UTSW 3 10335218 missense probably benign
R2171:Slc10a5 UTSW 3 10335282 missense possibly damaging 0.59
R2970:Slc10a5 UTSW 3 10335067 missense probably damaging 1.00
R2972:Slc10a5 UTSW 3 10334457 missense probably damaging 0.98
R2973:Slc10a5 UTSW 3 10334457 missense probably damaging 0.98
R4241:Slc10a5 UTSW 3 10335460 missense probably damaging 1.00
R4700:Slc10a5 UTSW 3 10335299 missense probably damaging 1.00
R4700:Slc10a5 UTSW 3 10335300 missense probably damaging 1.00
R4790:Slc10a5 UTSW 3 10335036 missense probably damaging 1.00
R4834:Slc10a5 UTSW 3 10334799 missense probably damaging 0.97
R4891:Slc10a5 UTSW 3 10334625 missense possibly damaging 0.79
R5220:Slc10a5 UTSW 3 10335088 nonsense probably null
R5748:Slc10a5 UTSW 3 10335331 missense probably benign 0.00
R6573:Slc10a5 UTSW 3 10335050 missense probably damaging 1.00
R6909:Slc10a5 UTSW 3 10335595 missense possibly damaging 0.90
R7355:Slc10a5 UTSW 3 10334315 nonsense probably null
R7807:Slc10a5 UTSW 3 10335469 missense probably benign 0.00
R7866:Slc10a5 UTSW 3 10334472 missense probably damaging 0.99
R8219:Slc10a5 UTSW 3 10335324 missense probably benign 0.32
Z1176:Slc10a5 UTSW 3 10334487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATTTGGATTAGGCTAGGTTAGG -3'
(R):5'- GTTGCTCTCGAAACTGGGATG -3'

Sequencing Primer
(F):5'- CATACACGTGCACACATGTAACATG -3'
(R):5'- CTCTCGAAACTGGGATGTTGAATAG -3'
Posted On2016-10-24