Incidental Mutation 'R5548:D3Ertd254e'
List |< first << previous [record 7 of 45] next >> last >|
ID434973
Institutional Source Beutler Lab
Gene Symbol D3Ertd254e
Ensembl Gene ENSMUSG00000033883
Gene NameDNA segment, Chr 3, ERATO Doi 254, expressed
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36151017-36170342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 36165491 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 554 (H554Q)
Ref Sequence ENSEMBL: ENSMUSP00000142829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165956] [ENSMUST00000197653] [ENSMUST00000205077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165956
AA Change: H553Q

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131779
Gene: ENSMUSG00000033883
AA Change: H553Q

DomainStartEndE-ValueType
KRAB 3 63 2.91e-34 SMART
ZnF_C2H2 342 364 1.08e-1 SMART
ZnF_C2H2 395 417 1.56e-2 SMART
ZnF_C2H2 423 445 3.11e-2 SMART
ZnF_C2H2 451 473 5.9e-3 SMART
ZnF_C2H2 479 501 1.82e-3 SMART
ZnF_C2H2 507 529 5.21e-4 SMART
ZnF_C2H2 535 557 1.84e-4 SMART
ZnF_C2H2 563 585 1.95e-3 SMART
ZnF_C2H2 591 613 2.05e-2 SMART
ZnF_C2H2 619 641 1.6e-4 SMART
ZnF_C2H2 647 669 5.21e-4 SMART
ZnF_C2H2 675 697 1.69e-3 SMART
ZnF_C2H2 703 725 2.61e-4 SMART
ZnF_C2H2 731 753 1.12e-3 SMART
ZnF_C2H2 759 779 3.85e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197653
AA Change: H554Q

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142829
Gene: ENSMUSG00000033883
AA Change: H554Q

DomainStartEndE-ValueType
KRAB 4 64 1.2e-36 SMART
ZnF_C2H2 343 365 4.4e-4 SMART
ZnF_C2H2 396 418 6.7e-5 SMART
ZnF_C2H2 424 446 1.3e-4 SMART
ZnF_C2H2 452 474 2.5e-5 SMART
ZnF_C2H2 480 502 7.9e-6 SMART
ZnF_C2H2 508 530 2.2e-6 SMART
ZnF_C2H2 536 558 7.7e-7 SMART
ZnF_C2H2 564 586 8e-6 SMART
ZnF_C2H2 592 614 8.9e-5 SMART
ZnF_C2H2 620 642 6.6e-7 SMART
ZnF_C2H2 648 670 2.2e-6 SMART
ZnF_C2H2 676 698 7.1e-6 SMART
ZnF_C2H2 704 726 1.1e-6 SMART
ZnF_C2H2 732 754 4.8e-6 SMART
ZnF_C2H2 760 780 1.6e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205077
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in D3Ertd254e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:D3Ertd254e APN 3 36164580 missense possibly damaging 0.86
IGL02089:D3Ertd254e APN 3 36164728 missense possibly damaging 0.53
IGL02162:D3Ertd254e APN 3 36164061 missense probably benign 0.18
R0243:D3Ertd254e UTSW 3 36165154 missense possibly damaging 0.47
R0512:D3Ertd254e UTSW 3 36166113 missense probably damaging 0.96
R0722:D3Ertd254e UTSW 3 36165069 missense probably benign 0.35
R0762:D3Ertd254e UTSW 3 36165867 missense possibly damaging 0.92
R0792:D3Ertd254e UTSW 3 36164562 missense probably benign 0.01
R0894:D3Ertd254e UTSW 3 36164786 nonsense probably null
R1731:D3Ertd254e UTSW 3 36164471 missense probably benign 0.18
R2098:D3Ertd254e UTSW 3 36166140 missense probably benign
R2099:D3Ertd254e UTSW 3 36164212 missense possibly damaging 0.86
R3709:D3Ertd254e UTSW 3 36159576 missense possibly damaging 0.71
R3808:D3Ertd254e UTSW 3 36165643 splice site probably null
R4035:D3Ertd254e UTSW 3 36164840 missense possibly damaging 0.53
R4288:D3Ertd254e UTSW 3 36159598 missense possibly damaging 0.71
R4289:D3Ertd254e UTSW 3 36159598 missense possibly damaging 0.71
R4959:D3Ertd254e UTSW 3 36164136 missense possibly damaging 0.91
R4973:D3Ertd254e UTSW 3 36164136 missense possibly damaging 0.91
R5102:D3Ertd254e UTSW 3 36162665 missense possibly damaging 0.73
R5462:D3Ertd254e UTSW 3 36165820 missense possibly damaging 0.95
R5782:D3Ertd254e UTSW 3 36164979 missense possibly damaging 0.73
R6153:D3Ertd254e UTSW 3 36165154 missense possibly damaging 0.47
R6225:D3Ertd254e UTSW 3 36166203 missense probably benign 0.18
R6602:D3Ertd254e UTSW 3 36164855 missense possibly damaging 0.86
R6785:D3Ertd254e UTSW 3 36165452 nonsense probably null
R7513:D3Ertd254e UTSW 3 36164643 missense possibly damaging 0.53
R7846:D3Ertd254e UTSW 3 36165589 missense probably benign 0.43
R8120:D3Ertd254e UTSW 3 36164491 missense possibly damaging 0.96
R8265:D3Ertd254e UTSW 3 36159528 start gained probably benign
R8415:D3Ertd254e UTSW 3 36165033 missense probably damaging 0.98
X0021:D3Ertd254e UTSW 3 36164191 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TTCAATCAAAGATCGACTGTTACTCA -3'
(R):5'- GGAACTGGATTTAAAGGCGCCA -3'

Sequencing Primer
(F):5'- AAGATCGAGCCTTAGTCTGC -3'
(R):5'- CTGGGTAAAAGCTTTGCCAC -3'
Posted On2016-10-24