Incidental Mutation 'R0190:Gtf3c4'
ID 43498
Institutional Source Beutler Lab
Gene Symbol Gtf3c4
Ensembl Gene ENSMUSG00000035666
Gene Name general transcription factor IIIC, polypeptide 4
Synonyms KAT12
MMRRC Submission 038451-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R0190 (G1)
Quality Score 92
Status Validated (trace)
Chromosome 2
Chromosomal Location 28822299-28840360 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 28840128 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 34 (D34Y)
Ref Sequence ENSEMBL: ENSMUSP00000042265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037117] [ENSMUST00000113853] [ENSMUST00000171404]
AlphaFold Q8BMQ2
Predicted Effect probably benign
Transcript: ENSMUST00000037117
AA Change: D34Y

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042265
Gene: ENSMUSG00000035666
AA Change: D34Y

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:TFIIIC_delta 59 250 1.1e-45 PFAM
low complexity region 609 621 N/A INTRINSIC
Pfam:zf-TFIIIC 728 816 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113853
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156468
Predicted Effect probably benign
Transcript: ENSMUST00000171404
SMART Domains Protein: ENSMUSP00000132171
Gene: ENSMUSG00000035666

DomainStartEndE-ValueType
Pfam:TFIIIC_delta 7 109 3.1e-17 PFAM
low complexity region 468 480 N/A INTRINSIC
Pfam:zf-TFIIIC 587 676 4.4e-26 PFAM
Meta Mutation Damage Score 0.1219 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 91.6%
  • 20x: 72.5%
Validation Efficiency 75% (45/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,392 probably null Het
Aff2 CA CAAA X: 69,849,105 probably null Het
Ankrd34a A G 3: 96,597,789 D103G probably damaging Het
Atp1b2 T C 11: 69,601,562 D224G probably damaging Het
Atxn10 A G 15: 85,336,529 D22G possibly damaging Het
B230118H07Rik G A 2: 101,586,430 S58L probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Caskin1 C T 17: 24,504,622 L795F possibly damaging Het
Cdk12 T C 11: 98,241,831 probably null Het
Crtc2 A G 3: 90,259,409 H91R probably damaging Het
Dbt A G 3: 116,539,087 probably null Het
Dda1 C A 8: 71,472,233 Y41* probably null Het
Dnah2 T A 11: 69,435,249 D3692V probably damaging Het
Dpep1 A G 8: 123,200,708 T334A probably benign Het
Enthd1 C T 15: 80,534,494 probably null Het
Fpr-rs6 T A 17: 20,182,479 I207F probably benign Het
Fsip2 T A 2: 82,985,177 S3751R possibly damaging Het
Gigyf2 A T 1: 87,428,688 probably benign Het
Igfn1 A T 1: 135,962,052 V2419E probably damaging Het
Kank1 A T 19: 25,409,283 I79L probably benign Het
Kif21b A G 1: 136,171,219 H1415R probably benign Het
Mad2l1 T C 6: 66,539,878 S185P possibly damaging Het
Mettl18 A G 1: 163,996,422 E104G probably damaging Het
Mrgprb2 G A 7: 48,552,777 H67Y possibly damaging Het
Mrgprd G A 7: 145,321,702 M103I probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Nucks1 A G 1: 131,924,591 D60G probably damaging Het
Olfr1245 T A 2: 89,574,958 Y256F probably damaging Het
Olfr275 G C 4: 52,825,613 W72S probably damaging Het
Olfr978 A G 9: 39,994,544 I245V probably benign Het
Paqr8 A G 1: 20,935,047 T142A probably benign Het
Pdss1 T C 2: 22,906,831 S119P probably damaging Het
Plcl2 A G 17: 50,607,643 D560G probably benign Het
Ppm1b T A 17: 84,994,103 V137E probably damaging Het
Ppp1r16b A C 2: 158,696,063 K35Q probably damaging Het
Prkd2 A T 7: 16,869,890 E832V probably damaging Het
Rab34 G T 11: 78,191,406 K191N possibly damaging Het
Rad51ap2 A C 12: 11,458,539 T821P probably benign Het
Rbm19 A G 5: 120,144,046 T823A probably benign Het
Rpf2 T G 10: 40,227,601 H106P probably damaging Het
Schip1 A G 3: 68,625,844 M453V probably benign Het
Sema5a T A 15: 32,562,774 N310K possibly damaging Het
Sf3b1 T C 1: 54,990,306 D1179G probably damaging Het
Skint2 A T 4: 112,616,532 T4S possibly damaging Het
Slc22a5 A T 11: 53,869,415 Y358* probably null Het
Slc34a1 T C 13: 55,409,101 M251T probably benign Het
Slc44a5 A G 3: 154,239,118 D124G probably null Het
Slc9b1 G A 3: 135,357,673 E73K unknown Het
Ssbp2 T C 13: 91,669,710 L156P probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Trim47 A G 11: 116,106,227 V568A probably damaging Het
Ttn A T 2: 76,887,980 probably benign Het
Ttpa A T 4: 20,021,260 I74F probably damaging Het
Vmn2r52 T C 7: 10,171,388 I175V probably benign Het
Wrn C T 8: 33,240,983 C1350Y probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp422 A T 6: 116,626,611 D142E probably damaging Het
Zfp473 A T 7: 44,733,188 C574S probably damaging Het
Zfp638 T A 6: 83,928,964 M37K probably damaging Het
Zfp976 C A 7: 42,642,524 probably benign Het
Other mutations in Gtf3c4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Gtf3c4 APN 2 28833572 missense probably benign
IGL01419:Gtf3c4 APN 2 28835069 missense probably damaging 1.00
IGL01574:Gtf3c4 APN 2 28834436 missense possibly damaging 0.50
IGL01778:Gtf3c4 APN 2 28835088 missense probably damaging 1.00
IGL01802:Gtf3c4 APN 2 28834080 missense probably damaging 1.00
IGL02560:Gtf3c4 APN 2 28834267 nonsense probably null
R0245:Gtf3c4 UTSW 2 28834964 missense possibly damaging 0.71
R0440:Gtf3c4 UTSW 2 28840169 splice site probably null
R0882:Gtf3c4 UTSW 2 28834770 missense probably damaging 1.00
R1757:Gtf3c4 UTSW 2 28830636 splice site probably benign
R1809:Gtf3c4 UTSW 2 28833976 nonsense probably null
R1893:Gtf3c4 UTSW 2 28834362 missense possibly damaging 0.92
R1903:Gtf3c4 UTSW 2 28839956 missense probably benign 0.19
R2020:Gtf3c4 UTSW 2 28833894 missense possibly damaging 0.81
R2867:Gtf3c4 UTSW 2 28839904 utr 5 prime probably benign
R3076:Gtf3c4 UTSW 2 28835153 missense possibly damaging 0.56
R4113:Gtf3c4 UTSW 2 28827555 missense probably damaging 1.00
R4404:Gtf3c4 UTSW 2 28826749 missense probably damaging 1.00
R5751:Gtf3c4 UTSW 2 28827499 missense probably damaging 1.00
R5997:Gtf3c4 UTSW 2 28833711 missense possibly damaging 0.62
R8162:Gtf3c4 UTSW 2 28834581 nonsense probably null
R9164:Gtf3c4 UTSW 2 28834649 missense probably benign 0.31
R9170:Gtf3c4 UTSW 2 28840202 missense possibly damaging 0.86
R9232:Gtf3c4 UTSW 2 28834836 missense probably damaging 1.00
R9308:Gtf3c4 UTSW 2 28834970 missense probably damaging 1.00
R9415:Gtf3c4 UTSW 2 28833954 missense possibly damaging 0.95
Z1177:Gtf3c4 UTSW 2 28835073 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCACATCGCAGATAAGCTCCAG -3'
(R):5'- ACCCAGTGTCTAGGAAAGGGACTC -3'

Sequencing Primer
(F):5'- ATAAGCTCCAGCACGGCG -3'
(R):5'- TTTCCAGACAGGCAGCTC -3'
Posted On 2013-05-24