Incidental Mutation 'R5548:Tmem132c'
List |< first << previous [record 36 of 45] next >> last >|
ID434982
Institutional Source Beutler Lab
Gene Symbol Tmem132c
Ensembl Gene ENSMUSG00000034324
Gene Nametransmembrane protein 132C
Synonyms2810482M11Rik, 4632425D07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location127241808-127565793 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 127551523 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 496 (Y496*)
Ref Sequence ENSEMBL: ENSMUSP00000113090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119026]
Predicted Effect probably null
Transcript: ENSMUST00000119026
AA Change: Y496*
SMART Domains Protein: ENSMUSP00000113090
Gene: ENSMUSG00000034324
AA Change: Y496*

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
Pfam:TMEM132D_N 58 187 1.2e-54 PFAM
Pfam:TMEM132 444 787 4.5e-143 PFAM
Pfam:TMEM132D_C 892 980 2.4e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132592
Predicted Effect probably benign
Transcript: ENSMUST00000145748
SMART Domains Protein: ENSMUSP00000121783
Gene: ENSMUSG00000034324

DomainStartEndE-ValueType
Pfam:TMEM132 1 112 6.2e-31 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Tmem132c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Tmem132c APN 5 127563242 missense possibly damaging 0.95
IGL00985:Tmem132c APN 5 127504866 missense probably damaging 0.99
IGL01599:Tmem132c APN 5 127359552 splice site probably benign
IGL01750:Tmem132c APN 5 127462959 missense possibly damaging 0.91
IGL01893:Tmem132c APN 5 127463029 missense possibly damaging 0.51
IGL02143:Tmem132c APN 5 127563402 missense probably benign 0.03
IGL02164:Tmem132c APN 5 127536377 missense probably damaging 1.00
IGL02252:Tmem132c APN 5 127462927 missense possibly damaging 0.91
IGL02527:Tmem132c APN 5 127359611 missense possibly damaging 0.95
IGL02584:Tmem132c APN 5 127504999 missense probably damaging 1.00
IGL02878:Tmem132c APN 5 127563090 missense probably damaging 0.99
IGL03065:Tmem132c APN 5 127563624 missense probably damaging 1.00
IGL03120:Tmem132c APN 5 127563384 missense probably benign 0.06
IGL03380:Tmem132c APN 5 127536442 missense probably benign 0.00
IGL03387:Tmem132c APN 5 127563720 missense probably benign 0.00
R0106:Tmem132c UTSW 5 127554669 missense possibly damaging 0.94
R0106:Tmem132c UTSW 5 127554669 missense possibly damaging 0.94
R0415:Tmem132c UTSW 5 127563705 missense probably damaging 1.00
R0607:Tmem132c UTSW 5 127563553 nonsense probably null
R1413:Tmem132c UTSW 5 127563567 missense probably damaging 1.00
R1531:Tmem132c UTSW 5 127359891 missense probably damaging 1.00
R1648:Tmem132c UTSW 5 127463056 splice site probably benign
R2148:Tmem132c UTSW 5 127462962 missense probably damaging 1.00
R2149:Tmem132c UTSW 5 127462962 missense probably damaging 1.00
R2259:Tmem132c UTSW 5 127504924 missense probably benign 0.01
R3853:Tmem132c UTSW 5 127359869 missense probably benign 0.00
R4204:Tmem132c UTSW 5 127563765 missense possibly damaging 0.73
R4543:Tmem132c UTSW 5 127504977 missense probably benign 0.00
R4701:Tmem132c UTSW 5 127564496 unclassified probably benign
R5017:Tmem132c UTSW 5 127563350 missense probably benign 0.13
R5037:Tmem132c UTSW 5 127553135 missense probably benign 0.42
R5327:Tmem132c UTSW 5 127563752 missense possibly damaging 0.50
R5423:Tmem132c UTSW 5 127563843 missense probably benign 0.02
R6425:Tmem132c UTSW 5 127553265 missense possibly damaging 0.95
R6717:Tmem132c UTSW 5 127564029 missense possibly damaging 0.93
R6899:Tmem132c UTSW 5 127551680 missense probably damaging 1.00
R7007:Tmem132c UTSW 5 127359615 missense probably damaging 1.00
R7297:Tmem132c UTSW 5 127360217 missense probably benign 0.06
R7326:Tmem132c UTSW 5 127564059 missense possibly damaging 0.51
R7386:Tmem132c UTSW 5 127563926 missense probably benign 0.16
R7504:Tmem132c UTSW 5 127554632 missense probably damaging 1.00
R7640:Tmem132c UTSW 5 127563006 missense probably damaging 1.00
R7718:Tmem132c UTSW 5 127563440 missense probably benign 0.06
R7762:Tmem132c UTSW 5 127554696 missense possibly damaging 0.90
R7818:Tmem132c UTSW 5 127564088 makesense probably null
R8117:Tmem132c UTSW 5 127360112 missense probably benign 0.22
R8425:Tmem132c UTSW 5 127564357 missense
X0067:Tmem132c UTSW 5 127536407 missense possibly damaging 0.79
Z1088:Tmem132c UTSW 5 127504921 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCTGCACTGGAAGCAAGTG -3'
(R):5'- TATCCTGGAGCCTGTCTTGG -3'

Sequencing Primer
(F):5'- AATGAGGCCCTGAGTTCAGATTCC -3'
(R):5'- TCTTGCTGGCCACGATG -3'
Posted On2016-10-24