Incidental Mutation 'R5548:N4bp2l1'
List |< first << previous [record 22 of 45] next >> last >|
ID434983
Institutional Source Beutler Lab
Gene Symbol N4bp2l1
Ensembl Gene ENSMUSG00000041132
Gene NameNEDD4 binding protein 2-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location150571644-150597188 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 150572955 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 65 (R65*)
Ref Sequence ENSEMBL: ENSMUSP00000144164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016279] [ENSMUST00000044620] [ENSMUST00000202031] [ENSMUST00000202279] [ENSMUST00000202291] [ENSMUST00000202313]
Predicted Effect probably null
Transcript: ENSMUST00000016279
AA Change: R169*
SMART Domains Protein: ENSMUSP00000016279
Gene: ENSMUSG00000041132
AA Change: R169*

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:AAA_33 42 176 6.1e-19 PFAM
Pfam:AAA_17 42 198 3.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044620
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201309
Predicted Effect probably null
Transcript: ENSMUST00000202031
AA Change: R65*
SMART Domains Protein: ENSMUSP00000144164
Gene: ENSMUSG00000041132
AA Change: R65*

DomainStartEndE-ValueType
SCOP:d1ly1a_ 8 71 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202279
SMART Domains Protein: ENSMUSP00000143792
Gene: ENSMUSG00000041132

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
SCOP:d1l4ua_ 42 58 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202291
Predicted Effect probably benign
Transcript: ENSMUST00000202313
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in N4bp2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01737:N4bp2l1 APN 5 150594316 missense possibly damaging 0.46
IGL02048:N4bp2l1 APN 5 150576638 critical splice donor site probably null
R0625:N4bp2l1 UTSW 5 150576745 nonsense probably null
R0763:N4bp2l1 UTSW 5 150594404 missense possibly damaging 0.66
R2372:N4bp2l1 UTSW 5 150572781 missense probably damaging 1.00
R7311:N4bp2l1 UTSW 5 150572924 missense probably damaging 1.00
R7414:N4bp2l1 UTSW 5 150576293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCATTAATATCCTTGGTGG -3'
(R):5'- ACAACATATGCTTCTGCCTGG -3'

Sequencing Primer
(F):5'- CCATTAATATCCTTGGTGGTGGCC -3'
(R):5'- GTCTCCTGAGGCAGAGCAGTAG -3'
Posted On2016-10-24