Mutagenetix > Incidental Mutations

Incidental Mutation 'R5548:Ttll3'

434985

Institutional Source

Beutler Lab

Gene Symbol

Ttll3

Ensembl Gene

ENSMUSG00000030276

Gene Name

tubulin tyrosine ligase-like family, member 3

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5548 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113389260-113414587 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113393117 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 139 (W139R)

Ref Sequence

ENSEMBL: ENSMUSP00000037870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000156898] [ENSMUST00000171058] [ENSMUST00000203578] [ENSMUST00000204026] [ENSMUST00000204802] [ENSMUST00000205017]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032414
AA Change: W139R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: W139R

Domain	Start	End	E-Value	Type
low complexity region	3	20	N/A	INTRINSIC
low complexity region	214	231	N/A	INTRINSIC
low complexity region	234	248	N/A	INTRINSIC
Pfam:TTL	404	698	7.7e-84	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000038889
AA Change: W139R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: W139R

Domain	Start	End	E-Value	Type
low complexity region	3	20	N/A	INTRINSIC
low complexity region	214	231	N/A	INTRINSIC
low complexity region	234	248	N/A	INTRINSIC
Pfam:TTL	404	699	9e-85	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129894
AA Change: W33R

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140505
AA Change: W100R

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146262
AA Change: W13R

Predicted Effect

probably benign
Transcript: ENSMUST00000156898

SMART Domains

Protein: ENSMUSP00000114839
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	167	8.3e-88	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171058

SMART Domains

Protein: ENSMUSP00000131690
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	91	1.1e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203524

Predicted Effect

probably benign
Transcript: ENSMUST00000203578

SMART Domains

Protein: ENSMUSP00000145344
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	77	1.2e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203925

Predicted Effect

probably benign
Transcript: ENSMUST00000204026

SMART Domains

Protein: ENSMUSP00000145049
Gene: ENSMUSG00000030276

Domain	Start	End	E-Value	Type
low complexity region	66	83	N/A	INTRINSIC
low complexity region	86	100	N/A	INTRINSIC
low complexity region	248	259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204683

Predicted Effect

probably benign
Transcript: ENSMUST00000204802

SMART Domains

Protein: ENSMUSP00000144751
Gene: ENSMUSG00000079426

Domain	Start	End	E-Value	Type
Pfam:ARPC4	1	77	1.2e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205017

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	C	10: 28,973,867	D191G	probably benign	Het
Ankrd39	C	T	1: 36,541,981	G96R	probably damaging	Het
C77080	GGTG	GGTGTG	4: 129,223,980		probably null	Het
Cdh12	C	T	15: 21,492,654	T253I	probably damaging	Het
Cox4i2	C	T	2: 152,757,091	T56I	possibly damaging	Het
Cpsf1	A	C	15: 76,597,327	D1141E	possibly damaging	Het
D3Ertd254e	C	G	3: 36,165,491	H554Q	possibly damaging	Het
Dennd5b	T	C	6: 149,019,349		probably null	Het
Dnah6	A	T	6: 73,151,689	D1194E	probably damaging	Het
Dst	C	A	1: 34,189,328	H1676N	probably benign	Het
Fitm1	A	G	14: 55,575,697	T6A	probably benign	Het
Galnt5	T	A	2: 58,014,910	V495E	probably damaging	Het
Gm8994	T	C	6: 136,329,570	V343A	probably damaging	Het
Gtf2h2	C	A	13: 100,481,036	R206L	possibly damaging	Het
Heatr5a	A	T	12: 51,958,951	Y80*	probably null	Het
Il17ra	A	G	6: 120,478,473	R348G	probably benign	Het
Mmp28	A	T	11: 83,443,907	Y340*	probably null	Het
Mrgprb8	A	T	7: 48,389,030	T150S	probably benign	Het
Ms4a10	A	T	19: 10,968,120		probably null	Het
Muc5b	A	T	7: 141,863,942	I3542F	probably benign	Het
Mybbp1a	T	C	11: 72,446,172	L578P	probably damaging	Het
N4bp2l1	G	A	5: 150,572,955	R65*	probably null	Het
Nup188	T	A	2: 30,326,493	Y770N	probably damaging	Het
Olfr284	T	A	15: 98,340,372	T206S	probably benign	Het
Olfr918	T	C	9: 38,673,304	I60V	probably benign	Het
Pbrm1	T	A	14: 31,105,424	C1257S	probably damaging	Het
Pcdh8	T	C	14: 79,767,502	T1028A	probably damaging	Het
Pramef25	C	T	4: 143,949,980	E185K	probably benign	Het
Qars	C	T	9: 108,512,918	P348S	possibly damaging	Het
Qrfpr	T	A	3: 36,221,926	Q105L	possibly damaging	Het
Slc10a5	A	T	3: 10,334,317	Y428N	probably benign	Het
Slc16a5	A	T	11: 115,469,804	Y271F	probably benign	Het
Slc1a4	T	A	11: 20,304,429	Q479L	possibly damaging	Het
Slc38a1	C	T	15: 96,590,474	G143S	probably damaging	Het
Susd1	G	A	4: 59,369,577	T364M	probably benign	Het
Tmem132c	T	A	5: 127,551,523	Y496*	probably null	Het
Tmem63b	A	G	17: 45,664,958	I523T	probably damaging	Het
Tnrc6c	T	C	11: 117,760,843	S1731P	possibly damaging	Het
Ubr4	C	T	4: 139,460,090	T3823M	probably damaging	Het
Vangl1	T	A	3: 102,184,446	D108V	possibly damaging	Het
Vmn1r120	T	C	7: 21,053,557	I76M	probably benign	Het
Wdr17	A	G	8: 54,703,851	Y17H	probably damaging	Het
Xkr4	C	T	1: 3,216,930	A346T	probably damaging	Het
Zfp600	T	A	4: 146,196,449	S562R	possibly damaging	Het

Other mutations in Ttll3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Ttll3	APN	6	113394729	missense	probably damaging	1.00
IGL01677:Ttll3	APN	6	113412984	missense	probably benign
IGL01697:Ttll3	APN	6	113399729	missense	probably benign	0.00
IGL01944:Ttll3	APN	6	113414115	missense	probably benign
IGL02688:Ttll3	APN	6	113399739	missense	probably benign	0.00
IGL03068:Ttll3	APN	6	113409197	missense	probably damaging	1.00
R0373:Ttll3	UTSW	6	113398777	missense	probably damaging	1.00
R0472:Ttll3	UTSW	6	113409339	missense	probably damaging	1.00
R0625:Ttll3	UTSW	6	113408903	critical splice acceptor site	probably null
R1868:Ttll3	UTSW	6	113392764	missense	possibly damaging	0.95
R2026:Ttll3	UTSW	6	113398770	missense	probably damaging	1.00
R2061:Ttll3	UTSW	6	113409042	missense	possibly damaging	0.76
R2128:Ttll3	UTSW	6	113412934	missense	probably benign	0.31
R2896:Ttll3	UTSW	6	113392722	missense	probably benign	0.15
R2903:Ttll3	UTSW	6	113407323	missense	probably damaging	0.99
R2906:Ttll3	UTSW	6	113392510	unclassified	probably benign
R4659:Ttll3	UTSW	6	113414141	missense	probably benign
R4746:Ttll3	UTSW	6	113407392	missense	probably damaging	1.00
R4984:Ttll3	UTSW	6	113412940	missense	probably benign	0.00
R5358:Ttll3	UTSW	6	113401331	missense	probably benign	0.26
R5372:Ttll3	UTSW	6	113401421	nonsense	probably null
R5525:Ttll3	UTSW	6	113412978	missense	probably benign
R5694:Ttll3	UTSW	6	113399708	missense	probably damaging	1.00
R5993:Ttll3	UTSW	6	113398031	nonsense	probably null
R6119:Ttll3	UTSW	6	113394741	missense	probably damaging	1.00
R6268:Ttll3	UTSW	6	113392563	missense	probably benign	0.00
R6719:Ttll3	UTSW	6	113399032	intron	probably benign
R6852:Ttll3	UTSW	6	113399155	frame shift	probably null
R6852:Ttll3	UTSW	6	113399157	frame shift	probably null
R6852:Ttll3	UTSW	6	113399159	frame shift	probably null
R6853:Ttll3	UTSW	6	113399157	frame shift	probably null
R6854:Ttll3	UTSW	6	113399157	frame shift	probably null
R7170:Ttll3	UTSW	6	113413878	missense	probably benign	0.41
R7239:Ttll3	UTSW	6	113399157	frame shift	probably null
R7302:Ttll3	UTSW	6	113409285	missense	probably damaging	1.00
R7330:Ttll3	UTSW	6	113399157	frame shift	probably null
R7330:Ttll3	UTSW	6	113399164	frame shift	probably null
R7586:Ttll3	UTSW	6	113399157	frame shift	probably null
R7587:Ttll3	UTSW	6	113399157	frame shift	probably null
R7701:Ttll3	UTSW	6	113399157	frame shift	probably null
R7702:Ttll3	UTSW	6	113399157	frame shift	probably null
R7776:Ttll3	UTSW	6	113399159	frame shift	probably null
R7793:Ttll3	UTSW	6	113399159	frame shift	probably null
R7797:Ttll3	UTSW	6	113394777	missense	possibly damaging	0.76
R7824:Ttll3	UTSW	6	113399157	frame shift	probably null
R7825:Ttll3	UTSW	6	113399157	frame shift	probably null
R7825:Ttll3	UTSW	6	113399159	frame shift	probably null
R7826:Ttll3	UTSW	6	113399157	frame shift	probably null
R7827:Ttll3	UTSW	6	113399157	frame shift	probably null
R7827:Ttll3	UTSW	6	113399162	frame shift	probably null
R7831:Ttll3	UTSW	6	113399157	frame shift	probably null
R7832:Ttll3	UTSW	6	113399157	frame shift	probably null
R7833:Ttll3	UTSW	6	113409337	missense	probably damaging	1.00
R7966:Ttll3	UTSW	6	113399157	frame shift	probably null
R8344:Ttll3	UTSW	6	113394998	missense	probably damaging	1.00
R8418:Ttll3	UTSW	6	113394773	missense	probably benign	0.04
R8768:Ttll3	UTSW	6	113408988	missense	probably damaging	1.00
R9017:Ttll3	UTSW	6	113412889	missense	probably benign	0.00
R9036:Ttll3	UTSW	6	113399696	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TGACACCCTATCGGCTTCAG -3'
(R):5'- CCAAGACTATGGCTCTGAGG -3'

Sequencing Primer
(F):5'- TCGGCTTCAGGCAGAGG -3'
(R):5'- TGGGGGTCACTTACAGAAGCATAC -3'

Posted On

2016-10-24