Incidental Mutation 'R5548:Vmn1r120'
ID434990
Institutional Source Beutler Lab
Gene Symbol Vmn1r120
Ensembl Gene ENSMUSG00000093986
Gene Namevomeronasal 1 receptor 120
SynonymsGm5730
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location21052867-21053784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21053557 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 76 (I76M)
Ref Sequence ENSEMBL: ENSMUSP00000100837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105202]
Predicted Effect probably benign
Transcript: ENSMUST00000105202
AA Change: I76M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000100837
Gene: ENSMUSG00000093986
AA Change: I76M

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 2.3e-15 PFAM
Pfam:7tm_1 31 286 3.6e-6 PFAM
Pfam:V1R 41 296 6.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Vmn1r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Vmn1r120 APN 7 21053010 missense probably benign 0.00
IGL02533:Vmn1r120 APN 7 21053138 missense probably damaging 1.00
IGL03261:Vmn1r120 APN 7 21053525 missense probably damaging 1.00
R0539:Vmn1r120 UTSW 7 21053472 missense probably damaging 0.99
R0973:Vmn1r120 UTSW 7 21053016 missense probably damaging 1.00
R1831:Vmn1r120 UTSW 7 21053631 missense probably benign
R2034:Vmn1r120 UTSW 7 21052958 missense possibly damaging 0.56
R2149:Vmn1r120 UTSW 7 21052964 missense probably damaging 0.98
R3437:Vmn1r120 UTSW 7 21053657 missense probably damaging 1.00
R5449:Vmn1r120 UTSW 7 21053149 missense possibly damaging 0.53
R5730:Vmn1r120 UTSW 7 21053009 missense possibly damaging 0.80
R6305:Vmn1r120 UTSW 7 21053606 missense possibly damaging 0.95
R7348:Vmn1r120 UTSW 7 21053452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGGGACACTAGCTCTGAG -3'
(R):5'- TCATCCAGGGTCCTGTAAAACC -3'

Sequencing Primer
(F):5'- TTGGGACACTAGCTCTGAGTATAAG -3'
(R):5'- GGTCCTGTAAAACCCTCTCAATG -3'
Posted On2016-10-24