Incidental Mutation 'R5548:Mrgprb8'
ID434991
Institutional Source Beutler Lab
Gene Symbol Mrgprb8
Ensembl Gene ENSMUSG00000050870
Gene NameMAS-related GPR, member B8
SynonymsMrgB8
Accession Numbers

Genbank: NM_207539;  MGI: 3033134

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48388526-48389648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48389030 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 150 (T150S)
Ref Sequence ENSEMBL: ENSMUSP00000052230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056676]
Predicted Effect probably benign
Transcript: ENSMUST00000056676
AA Change: T150S

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052230
Gene: ENSMUSG00000050870
AA Change: T150S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 37 219 3.9e-7 PFAM
low complexity region 302 327 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Mrgprb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02031:Mrgprb8 APN 7 48389339 missense probably benign 0.01
IGL02191:Mrgprb8 APN 7 48388779 missense probably damaging 1.00
IGL02449:Mrgprb8 APN 7 48388683 nonsense probably null
IGL02724:Mrgprb8 APN 7 48389373 missense possibly damaging 0.85
IGL02927:Mrgprb8 APN 7 48388625 nonsense probably null
astroclast1 UTSW 7 48389144 missense probably benign 0.05
A4554:Mrgprb8 UTSW 7 48389408 missense probably damaging 1.00
R0676:Mrgprb8 UTSW 7 48388664 missense probably benign
R0890:Mrgprb8 UTSW 7 48389029 nonsense probably null
R2094:Mrgprb8 UTSW 7 48389205 missense probably benign 0.16
R2102:Mrgprb8 UTSW 7 48388886 missense possibly damaging 0.56
R4839:Mrgprb8 UTSW 7 48388908 missense probably benign 0.18
R5370:Mrgprb8 UTSW 7 48388820 missense probably benign 0.00
R5471:Mrgprb8 UTSW 7 48388723 missense probably damaging 1.00
R6165:Mrgprb8 UTSW 7 48388817 missense possibly damaging 0.78
R6199:Mrgprb8 UTSW 7 48389303 missense probably benign 0.00
R6315:Mrgprb8 UTSW 7 48389235 missense probably damaging 1.00
R6797:Mrgprb8 UTSW 7 48389144 missense probably benign 0.05
R6924:Mrgprb8 UTSW 7 48389123 missense possibly damaging 0.71
R8219:Mrgprb8 UTSW 7 48388901 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTCCCTGGAAAATCTCATTAGGC -3'
(R):5'- ACAGGTGTCTGCTGTGAACC -3'

Sequencing Primer
(F):5'- TAGGCAGTTTCACTACATCGAC -3'
(R):5'- TGTGAACCACAGAAGACCCTG -3'
Posted On2016-10-24