Incidental Mutation 'R5548:Mybbp1a'
ID434999
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene NameMYB binding protein (P160) 1a
Synonymsp160MBP, p67MBP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5548 (G1)
Quality Score224
Status Not validated
Chromosome11
Chromosomal Location72441355-72451768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72446172 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 578 (L578P)
Ref Sequence ENSEMBL: ENSMUSP00000044827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045633]
Predicted Effect probably damaging
Transcript: ENSMUST00000045633
AA Change: L578P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463
AA Change: L578P

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72443567 missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72445666 missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72443918 splice site probably benign
IGL03344:Mybbp1a APN 11 72445202 missense probably damaging 1.00
fratelli UTSW 11 72445712 missense probably benign 0.02
nonnae UTSW 11 72446012 missense probably damaging 1.00
sorelli UTSW 11 72447759 missense possibly damaging 0.94
R0276:Mybbp1a UTSW 11 72450107 splice site probably null
R0437:Mybbp1a UTSW 11 72448848 missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72448376 missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72443648 missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72445217 missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1894:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72441445 missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72446195 missense probably benign 0.10
R3739:Mybbp1a UTSW 11 72448737 missense possibly damaging 0.77
R3983:Mybbp1a UTSW 11 72447170 missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72451287 missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72445712 missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72447971 missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72445640 missense probably damaging 1.00
R4982:Mybbp1a UTSW 11 72445214 missense probably damaging 0.99
R5451:Mybbp1a UTSW 11 72448113 missense probably damaging 0.99
R5514:Mybbp1a UTSW 11 72450636 missense possibly damaging 0.61
R5673:Mybbp1a UTSW 11 72444925 missense probably benign 0.30
R5947:Mybbp1a UTSW 11 72442431 missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72446012 missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72447566 missense probably benign 0.00
R7154:Mybbp1a UTSW 11 72447642 splice site probably null
R7227:Mybbp1a UTSW 11 72447759 missense possibly damaging 0.94
R7238:Mybbp1a UTSW 11 72443512 missense probably damaging 1.00
R7441:Mybbp1a UTSW 11 72451275 missense probably benign 0.01
R7833:Mybbp1a UTSW 11 72442901 splice site probably null
R8213:Mybbp1a UTSW 11 72444721 missense probably damaging 1.00
R8324:Mybbp1a UTSW 11 72445288 critical splice donor site probably null
X0050:Mybbp1a UTSW 11 72441677 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTTCAGTTGGCAGACATG -3'
(R):5'- GCAGGACTGAATTGGCTTAGG -3'

Sequencing Primer
(F):5'- TGCTGTTGAACCATAACCGCAATG -3'
(R):5'- CAGGACTGAATTGGCTTAGGAAATTC -3'
Posted On2016-10-24