Incidental Mutation 'R0190:Or4a72'
ID 43500
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission 038451-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R0190 (G1)
Quality Score 85
Status Not validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89405302 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 256 (Y256F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000099766
AA Change: Y256F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: Y256F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099773
AA Change: Y256F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097361
Gene: ENSMUSG00000075083
AA Change: Y256F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214870
AA Change: Y256F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217402
AA Change: Y256F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 91.6%
  • 20x: 72.5%
Validation Efficiency 75% (45/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,966,429 (GRCm39) probably null Het
Aff2 CA CAAA X: 68,892,711 (GRCm39) probably null Het
Ankrd34a A G 3: 96,505,105 (GRCm39) D103G probably damaging Het
Atp1b2 T C 11: 69,492,388 (GRCm39) D224G probably damaging Het
Atxn10 A G 15: 85,220,730 (GRCm39) D22G possibly damaging Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
Caskin1 C T 17: 24,723,596 (GRCm39) L795F possibly damaging Het
Cdk12 T C 11: 98,132,657 (GRCm39) probably null Het
Crtc2 A G 3: 90,166,716 (GRCm39) H91R probably damaging Het
Dbt A G 3: 116,332,736 (GRCm39) probably null Het
Dda1 C A 8: 71,924,877 (GRCm39) Y41* probably null Het
Dnah2 T A 11: 69,326,075 (GRCm39) D3692V probably damaging Het
Dpep1 A G 8: 123,927,447 (GRCm39) T334A probably benign Het
Enthd1 C T 15: 80,418,695 (GRCm39) probably null Het
Fpr-rs6 T A 17: 20,402,741 (GRCm39) I207F probably benign Het
Fsip2 T A 2: 82,815,521 (GRCm39) S3751R possibly damaging Het
Gigyf2 A T 1: 87,356,410 (GRCm39) probably benign Het
Gtf3c4 C A 2: 28,730,140 (GRCm39) D34Y probably benign Het
Iftap G A 2: 101,416,775 (GRCm39) S58L probably benign Het
Igfn1 A T 1: 135,889,790 (GRCm39) V2419E probably damaging Het
Kank1 A T 19: 25,386,647 (GRCm39) I79L probably benign Het
Kif21b A G 1: 136,098,957 (GRCm39) H1415R probably benign Het
Mad2l1 T C 6: 66,516,862 (GRCm39) S185P possibly damaging Het
Mettl18 A G 1: 163,823,991 (GRCm39) E104G probably damaging Het
Mrgprb2 G A 7: 48,202,525 (GRCm39) H67Y possibly damaging Het
Mrgprd G A 7: 144,875,439 (GRCm39) M103I probably benign Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Npc1 G A 18: 12,324,887 (GRCm39) T1202I probably damaging Het
Nucks1 A G 1: 131,852,329 (GRCm39) D60G probably damaging Het
Or10g7 A G 9: 39,905,840 (GRCm39) I245V probably benign Het
Or13f5 G C 4: 52,825,613 (GRCm39) W72S probably damaging Het
Paqr8 A G 1: 21,005,271 (GRCm39) T142A probably benign Het
Pdss1 T C 2: 22,796,843 (GRCm39) S119P probably damaging Het
Plcl2 A G 17: 50,914,671 (GRCm39) D560G probably benign Het
Ppm1b T A 17: 85,301,531 (GRCm39) V137E probably damaging Het
Ppp1r16b A C 2: 158,537,983 (GRCm39) K35Q probably damaging Het
Prkd2 A T 7: 16,603,815 (GRCm39) E832V probably damaging Het
Rab34 G T 11: 78,082,232 (GRCm39) K191N possibly damaging Het
Rad51ap2 A C 12: 11,508,540 (GRCm39) T821P probably benign Het
Rbm19 A G 5: 120,282,111 (GRCm39) T823A probably benign Het
Rpf2 T G 10: 40,103,597 (GRCm39) H106P probably damaging Het
Schip1 A G 3: 68,533,177 (GRCm39) M453V probably benign Het
Sema5a T A 15: 32,562,920 (GRCm39) N310K possibly damaging Het
Sf3b1 T C 1: 55,029,465 (GRCm39) D1179G probably damaging Het
Skint2 A T 4: 112,473,729 (GRCm39) T4S possibly damaging Het
Slc22a5 A T 11: 53,760,241 (GRCm39) Y358* probably null Het
Slc34a1 T C 13: 55,556,914 (GRCm39) M251T probably benign Het
Slc44a5 A G 3: 153,944,755 (GRCm39) D124G probably null Het
Slc9b1 G A 3: 135,063,434 (GRCm39) E73K unknown Het
Ssbp2 T C 13: 91,817,829 (GRCm39) L156P probably damaging Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Trim47 A G 11: 115,997,053 (GRCm39) V568A probably damaging Het
Ttn A T 2: 76,718,324 (GRCm39) probably benign Het
Ttpa A T 4: 20,021,260 (GRCm39) I74F probably damaging Het
Vmn2r52 T C 7: 9,905,315 (GRCm39) I175V probably benign Het
Wrn C T 8: 33,731,011 (GRCm39) C1350Y probably benign Het
Zfp11 C T 5: 129,735,302 (GRCm39) G53E possibly damaging Het
Zfp422 A T 6: 116,603,572 (GRCm39) D142E probably damaging Het
Zfp473 A T 7: 44,382,612 (GRCm39) C574S probably damaging Het
Zfp638 T A 6: 83,905,946 (GRCm39) M37K probably damaging Het
Zfp976 C A 7: 42,291,948 (GRCm39) probably benign Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2018:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2019:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2020:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2021:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R3850:Or4a72 UTSW 2 89,405,378 (GRCm39) missense probably damaging 0.99
R4066:Or4a72 UTSW 2 89,405,523 (GRCm39) missense probably damaging 1.00
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R5574:Or4a72 UTSW 2 89,405,321 (GRCm39) missense possibly damaging 0.94
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6188:Or4a72 UTSW 2 89,405,538 (GRCm39) nonsense probably null
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8558:Or4a72 UTSW 2 89,405,329 (GRCm39) missense probably damaging 1.00
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
R9482:Or4a72 UTSW 2 89,405,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTGCAATGGACAAGACCACACAC -3'
(R):5'- CATCATGAATCGAAGGGTTTGCATCAC -3'

Sequencing Primer
(F):5'- ACACACCCTTTGTTTATAACACTG -3'
(R):5'- TGCACAGACACCTACTTCATTGG -3'
Posted On 2013-05-24