Incidental Mutation 'R5548:Mmp28'
ID435000
Institutional Source Beutler Lab
Gene Symbol Mmp28
Ensembl Gene ENSMUSG00000020682
Gene Namematrix metallopeptidase 28 (epilysin)
Synonymsepilysin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83440768-83463071 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 83443907 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 340 (Y340*)
Ref Sequence ENSEMBL: ENSMUSP00000112566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021020] [ENSMUST00000021020] [ENSMUST00000037378] [ENSMUST00000103209] [ENSMUST00000108137] [ENSMUST00000119346] [ENSMUST00000188702]
Predicted Effect probably null
Transcript: ENSMUST00000021020
SMART Domains Protein: ENSMUSP00000021020
Gene: ENSMUSG00000020682

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 1e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 361 7.46e0 SMART
HX 363 406 1.64e-1 SMART
HX 408 454 1.78e-2 SMART
HX 456 500 5.79e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021020
SMART Domains Protein: ENSMUSP00000021020
Gene: ENSMUSG00000020682

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 1e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 361 7.46e0 SMART
HX 363 406 1.64e-1 SMART
HX 408 454 1.78e-2 SMART
HX 456 500 5.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037378
SMART Domains Protein: ENSMUSP00000042098
Gene: ENSMUSG00000035085

DomainStartEndE-ValueType
Pfam:DUF4637 5 169 1.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103209
SMART Domains Protein: ENSMUSP00000099498
Gene: ENSMUSG00000020682

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 9.7e-12 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 349 392 1.64e-1 SMART
HX 394 440 1.78e-2 SMART
HX 442 486 5.79e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108137
AA Change: Y340*
SMART Domains Protein: ENSMUSP00000103772
Gene: ENSMUSG00000020682
AA Change: Y340*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 2.6e-11 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 371 2.72e-7 SMART
HX 373 416 1.64e-1 SMART
HX 418 464 1.78e-2 SMART
HX 466 510 5.79e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119346
AA Change: Y340*
SMART Domains Protein: ENSMUSP00000112566
Gene: ENSMUSG00000020682
AA Change: Y340*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:PG_binding_1 31 86 7.4e-12 PFAM
low complexity region 114 125 N/A INTRINSIC
ZnMc 126 285 3.92e-39 SMART
HX 328 371 2.72e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188702
SMART Domains Protein: ENSMUSP00000140664
Gene: ENSMUSG00000035085

DomainStartEndE-ValueType
Pfam:DUF4637 6 111 2.8e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix for both normal physiological processes, such as embryonic development, reproduction and tissue remodeling, and disease processes, such as asthma and metastasis. This gene encodes a secreted enzyme that degrades casein. Its expression pattern suggests that it plays a role in tissue homeostasis and in wound repair. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Null homozygote mice have enhanced chemotaxis of macrophages into the lung upon infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Mmp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Mmp28 APN 11 83443776 missense possibly damaging 0.93
IGL02559:Mmp28 APN 11 83447740 missense probably benign 0.00
R0399:Mmp28 UTSW 11 83451732 missense probably damaging 1.00
R0492:Mmp28 UTSW 11 83443803 missense probably damaging 1.00
R1432:Mmp28 UTSW 11 83442939 missense probably damaging 1.00
R1822:Mmp28 UTSW 11 83444219 missense probably damaging 0.99
R2181:Mmp28 UTSW 11 83442717 missense possibly damaging 0.92
R5346:Mmp28 UTSW 11 83442663 missense probably benign
R5532:Mmp28 UTSW 11 83442858 missense probably damaging 1.00
R7580:Mmp28 UTSW 11 83444832 missense probably damaging 0.98
R7882:Mmp28 UTSW 11 83443926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGACTCAAGGCTGGTAC -3'
(R):5'- GTCCAGAGCTGAATTACAAGGTG -3'

Sequencing Primer
(F):5'- CCTTTAAAGAAGTAGAAGTCTCCATC -3'
(R):5'- TGGGGAGATCTAGGATATAGAAATCC -3'
Posted On2016-10-24