Mutagenetix > Incidental Mutations

Incidental Mutation 'R5548:Heatr5a'

435003

Institutional Source

Beutler Lab

Gene Symbol

Heatr5a

Ensembl Gene

ENSMUSG00000035181

Gene Name

HEAT repeat containing 5A

Synonyms

D930036F22Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.218) question?

Stock #

R5548 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

51875871-51971321 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 51958951 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 80 (Y80*)

Ref Sequence

ENSEMBL: ENSMUSP00000043115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040583]

Predicted Effect

probably null
Transcript: ENSMUST00000040583
AA Change: Y80*

SMART Domains

Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: Y80*

Domain	Start	End	E-Value	Type
low complexity region	56	67	N/A	INTRINSIC
SCOP:d1qbkb_	112	658	6e-13	SMART
low complexity region	1063	1078	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1110	1120	N/A	INTRINSIC
low complexity region	1122	1135	N/A	INTRINSIC
low complexity region	1496	1507	N/A	INTRINSIC
low complexity region	1722	1735	N/A	INTRINSIC
low complexity region	1925	1936	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218254

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	C	10: 28,973,867	D191G	probably benign	Het
Ankrd39	C	T	1: 36,541,981	G96R	probably damaging	Het
C77080	GGTG	GGTGTG	4: 129,223,980		probably null	Het
Cdh12	C	T	15: 21,492,654	T253I	probably damaging	Het
Cox4i2	C	T	2: 152,757,091	T56I	possibly damaging	Het
Cpsf1	A	C	15: 76,597,327	D1141E	possibly damaging	Het
D3Ertd254e	C	G	3: 36,165,491	H554Q	possibly damaging	Het
Dennd5b	T	C	6: 149,019,349		probably null	Het
Dnah6	A	T	6: 73,151,689	D1194E	probably damaging	Het
Dst	C	A	1: 34,189,328	H1676N	probably benign	Het
Fitm1	A	G	14: 55,575,697	T6A	probably benign	Het
Galnt5	T	A	2: 58,014,910	V495E	probably damaging	Het
Gm8994	T	C	6: 136,329,570	V343A	probably damaging	Het
Gtf2h2	C	A	13: 100,481,036	R206L	possibly damaging	Het
Il17ra	A	G	6: 120,478,473	R348G	probably benign	Het
Mmp28	A	T	11: 83,443,907	Y340*	probably null	Het
Mrgprb8	A	T	7: 48,389,030	T150S	probably benign	Het
Ms4a10	A	T	19: 10,968,120		probably null	Het
Muc5b	A	T	7: 141,863,942	I3542F	probably benign	Het
Mybbp1a	T	C	11: 72,446,172	L578P	probably damaging	Het
N4bp2l1	G	A	5: 150,572,955	R65*	probably null	Het
Nup188	T	A	2: 30,326,493	Y770N	probably damaging	Het
Olfr284	T	A	15: 98,340,372	T206S	probably benign	Het
Olfr918	T	C	9: 38,673,304	I60V	probably benign	Het
Pbrm1	T	A	14: 31,105,424	C1257S	probably damaging	Het
Pcdh8	T	C	14: 79,767,502	T1028A	probably damaging	Het
Pramef25	C	T	4: 143,949,980	E185K	probably benign	Het
Qars	C	T	9: 108,512,918	P348S	possibly damaging	Het
Qrfpr	T	A	3: 36,221,926	Q105L	possibly damaging	Het
Slc10a5	A	T	3: 10,334,317	Y428N	probably benign	Het
Slc16a5	A	T	11: 115,469,804	Y271F	probably benign	Het
Slc1a4	T	A	11: 20,304,429	Q479L	possibly damaging	Het
Slc38a1	C	T	15: 96,590,474	G143S	probably damaging	Het
Susd1	G	A	4: 59,369,577	T364M	probably benign	Het
Tmem132c	T	A	5: 127,551,523	Y496*	probably null	Het
Tmem63b	A	G	17: 45,664,958	I523T	probably damaging	Het
Tnrc6c	T	C	11: 117,760,843	S1731P	possibly damaging	Het
Ttll3	T	A	6: 113,393,117	W139R	probably damaging	Het
Ubr4	C	T	4: 139,460,090	T3823M	probably damaging	Het
Vangl1	T	A	3: 102,184,446	D108V	possibly damaging	Het
Vmn1r120	T	C	7: 21,053,557	I76M	probably benign	Het
Wdr17	A	G	8: 54,703,851	Y17H	probably damaging	Het
Xkr4	C	T	1: 3,216,930	A346T	probably damaging	Het
Zfp600	T	A	4: 146,196,449	S562R	possibly damaging	Het

Other mutations in Heatr5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Heatr5a	APN	12	51888901	missense	probably damaging	0.99
IGL01397:Heatr5a	APN	12	51894369	missense	possibly damaging	0.89
IGL01481:Heatr5a	APN	12	51955425	missense	probably damaging	1.00
IGL01684:Heatr5a	APN	12	51955511	missense	probably benign	0.36
IGL01766:Heatr5a	APN	12	51889664	missense	probably benign	0.15
IGL01799:Heatr5a	APN	12	51897835	missense	probably benign	0.17
IGL02007:Heatr5a	APN	12	51916158	missense	probably damaging	1.00
IGL02093:Heatr5a	APN	12	51916075	missense	possibly damaging	0.68
IGL02205:Heatr5a	APN	12	51877337	missense	probably damaging	1.00
IGL02450:Heatr5a	APN	12	51945430	missense	probably benign	0.02
IGL02565:Heatr5a	APN	12	51951099	missense	possibly damaging	0.54
IGL02707:Heatr5a	APN	12	51921366	missense	probably benign	0.01
IGL02735:Heatr5a	APN	12	51915021	missense	probably damaging	0.99
IGL03160:Heatr5a	APN	12	51884496	splice site	probably benign
F5770:Heatr5a	UTSW	12	51881278	splice site	probably benign
R0034:Heatr5a	UTSW	12	51925172	missense	probably damaging	1.00
R0127:Heatr5a	UTSW	12	51925405	missense	probably benign
R0184:Heatr5a	UTSW	12	51909969	missense	probably benign	0.00
R0362:Heatr5a	UTSW	12	51888861	missense	probably damaging	1.00
R0567:Heatr5a	UTSW	12	51910089	missense	probably damaging	1.00
R0591:Heatr5a	UTSW	12	51910101	splice site	probably benign
R0736:Heatr5a	UTSW	12	51896561	critical splice donor site	probably null
R1532:Heatr5a	UTSW	12	51952518	missense	probably damaging	0.99
R1914:Heatr5a	UTSW	12	51905467	missense	probably damaging	1.00
R1956:Heatr5a	UTSW	12	51945419	critical splice donor site	probably null
R1978:Heatr5a	UTSW	12	51939658	missense	possibly damaging	0.77
R2044:Heatr5a	UTSW	12	51955403	missense	probably benign	0.19
R2263:Heatr5a	UTSW	12	51916150	missense	probably damaging	0.97
R2265:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2267:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2268:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2269:Heatr5a	UTSW	12	51893745	missense	possibly damaging	0.68
R2842:Heatr5a	UTSW	12	51955478	missense	probably null	1.00
R2842:Heatr5a	UTSW	12	51955477	splice site	probably null
R3033:Heatr5a	UTSW	12	51951038	nonsense	probably null
R4303:Heatr5a	UTSW	12	51956225	missense	probably benign	0.01
R4675:Heatr5a	UTSW	12	51877347	missense	probably benign	0.17
R4718:Heatr5a	UTSW	12	51916163	missense	possibly damaging	0.95
R4807:Heatr5a	UTSW	12	51877520	missense	probably damaging	1.00
R5114:Heatr5a	UTSW	12	51956237	nonsense	probably null
R5229:Heatr5a	UTSW	12	51947978	missense	probably benign	0.33
R5411:Heatr5a	UTSW	12	51888243	missense	probably damaging	1.00
R5603:Heatr5a	UTSW	12	51877575	missense	probably benign	0.26
R5631:Heatr5a	UTSW	12	51955527	missense	probably benign	0.22
R5742:Heatr5a	UTSW	12	51955552	nonsense	probably null
R5969:Heatr5a	UTSW	12	51959040	missense	probably benign
R6020:Heatr5a	UTSW	12	51884327	missense	probably benign	0.01
R6234:Heatr5a	UTSW	12	51877454	missense	possibly damaging	0.69
R6352:Heatr5a	UTSW	12	51951166	missense	possibly damaging	0.88
R6798:Heatr5a	UTSW	12	51881265	missense	probably benign	0.01
R6815:Heatr5a	UTSW	12	51955508	missense	possibly damaging	0.89
R7059:Heatr5a	UTSW	12	51888234	missense	probably damaging	0.98
R7143:Heatr5a	UTSW	12	51961468	missense	probably benign	0.09
R7178:Heatr5a	UTSW	12	51925142	missense	probably damaging	0.99
R7291:Heatr5a	UTSW	12	51925339	missense	probably damaging	0.97
R7454:Heatr5a	UTSW	12	51961543	missense	probably benign	0.20
R7511:Heatr5a	UTSW	12	51879434	missense	possibly damaging	0.94
R7636:Heatr5a	UTSW	12	51888196	missense	probably damaging	1.00
R7636:Heatr5a	UTSW	12	51952558	missense	probably damaging	1.00
R7665:Heatr5a	UTSW	12	51961530	missense	probably damaging	1.00
R8088:Heatr5a	UTSW	12	51947996	missense	possibly damaging	0.85
R8205:Heatr5a	UTSW	12	51959009	missense	probably benign	0.05
R8212:Heatr5a	UTSW	12	51899229	missense	probably benign	0.00
R8213:Heatr5a	UTSW	12	51891443	missense	probably damaging	0.96
R8323:Heatr5a	UTSW	12	51955506	missense	probably benign	0.02
R8326:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8339:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8395:Heatr5a	UTSW	12	51916178	missense
R8410:Heatr5a	UTSW	12	51938120	missense	probably benign	0.01
R8676:Heatr5a	UTSW	12	51887919	critical splice donor site	probably benign
R8834:Heatr5a	UTSW	12	51909956	critical splice donor site	probably null
V7732:Heatr5a	UTSW	12	51905324	missense	possibly damaging	0.65
Z1088:Heatr5a	UTSW	12	51891404	missense	probably damaging	1.00
Z1088:Heatr5a	UTSW	12	51951076	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- ACGCTTAATTTCAAAACCAACTGTC -3'
(R):5'- AACTGTGAGCCCCAGTCAG -3'

Sequencing Primer
(F):5'- ATGTTTAACTTACAGTTTGGTGG -3'
(R):5'- CAGAACAGTGCTGCGTGTTC -3'

Posted On

2016-10-24