Incidental Mutation 'R5548:Heatr5a'
List |< first << previous [record 15 of 45] next >> last >|
ID435003
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene NameHEAT repeat containing 5A
SynonymsD930036F22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location51875871-51971321 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 51958951 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 80 (Y80*)
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
Predicted Effect probably null
Transcript: ENSMUST00000040583
AA Change: Y80*
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: Y80*

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218254
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 splice site probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
R8088:Heatr5a UTSW 12 51947996 missense possibly damaging 0.85
R8205:Heatr5a UTSW 12 51959009 missense probably benign 0.05
R8212:Heatr5a UTSW 12 51899229 missense probably benign 0.00
R8213:Heatr5a UTSW 12 51891443 missense probably damaging 0.96
R8323:Heatr5a UTSW 12 51955506 missense probably benign 0.02
R8326:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8339:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8395:Heatr5a UTSW 12 51916178 missense
R8410:Heatr5a UTSW 12 51938120 missense probably benign 0.01
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACGCTTAATTTCAAAACCAACTGTC -3'
(R):5'- AACTGTGAGCCCCAGTCAG -3'

Sequencing Primer
(F):5'- ATGTTTAACTTACAGTTTGGTGG -3'
(R):5'- CAGAACAGTGCTGCGTGTTC -3'
Posted On2016-10-24