Incidental Mutation 'R5548:Gtf2h2'
List |< first << previous [record 14 of 45] next >> last >|
ID435004
Institutional Source Beutler Lab
Gene Symbol Gtf2h2
Ensembl Gene ENSMUSG00000021639
Gene Namegeneral transcription factor II H, polypeptide 2
Synonymsbasal transcription factor 2, p44 subunit, 44kDa, p44, Btf2p44
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100460218-100492579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100481036 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 206 (R206L)
Ref Sequence ENSEMBL: ENSMUSP00000065228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066940] [ENSMUST00000066984] [ENSMUST00000134842] [ENSMUST00000145266]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066940
SMART Domains Protein: ENSMUSP00000064590
Gene: ENSMUSG00000021639

DomainStartEndE-ValueType
Pfam:VWA_2 60 166 5e-9 PFAM
Pfam:Ssl1 64 166 1.1e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000066984
AA Change: R206L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065228
Gene: ENSMUSG00000021639
AA Change: R206L

DomainStartEndE-ValueType
VWA 58 240 1.02e-14 SMART
Blast:BIR 291 310 6e-7 BLAST
C1_4 345 388 3.13e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124698
Predicted Effect probably benign
Transcript: ENSMUST00000134842
SMART Domains Protein: ENSMUSP00000138748
Gene: ENSMUSG00000021639

DomainStartEndE-ValueType
Pfam:Ssl1 64 139 2.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142182
Predicted Effect possibly damaging
Transcript: ENSMUST00000145266
AA Change: R206L

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138108
Gene: ENSMUSG00000021639
AA Change: R206L

DomainStartEndE-ValueType
VWA 58 240 1.02e-14 SMART
Blast:BIR 291 310 6e-7 BLAST
C1_4 345 388 3.13e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232450
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This gene is within the telomeric copy of the duplication. Deletion of this gene sometimes accompanies deletion of the neighboring SMN1 gene in spinal muscular atrophy (SMA) patients but it is unclear if deletion of this gene contributes to the SMA phenotype. This gene encodes the 44 kDa subunit of RNA polymerase II transcription initiation factor IIH which is involved in basal transcription and nucleotide excision repair. Transcript variants for this gene have been described, but their full length nature has not been determined. A second copy of this gene within the centromeric copy of the duplication has been described in the literature. It is reported to be different by either two or four base pairs; however, no sequence data is currently available for the centromeric copy of the gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Gtf2h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gtf2h2 APN 13 100480998 unclassified probably benign
IGL00780:Gtf2h2 APN 13 100479221 missense probably benign 0.01
IGL01475:Gtf2h2 APN 13 100481033 missense probably damaging 1.00
IGL02298:Gtf2h2 APN 13 100481039 missense probably damaging 1.00
IGL02754:Gtf2h2 APN 13 100481239 missense probably damaging 1.00
R0602:Gtf2h2 UTSW 13 100469025 missense probably benign 0.03
R0621:Gtf2h2 UTSW 13 100488925 missense probably damaging 1.00
R0665:Gtf2h2 UTSW 13 100481054 missense probably damaging 1.00
R4709:Gtf2h2 UTSW 13 100469015 nonsense probably null
R4810:Gtf2h2 UTSW 13 100481002 critical splice donor site probably null
R5262:Gtf2h2 UTSW 13 100481848 unclassified probably benign
R5741:Gtf2h2 UTSW 13 100480558 missense probably benign 0.00
R6802:Gtf2h2 UTSW 13 100480543 missense probably benign 0.39
R7256:Gtf2h2 UTSW 13 100479201 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCGCTTCTGTGTAAAACCTACC -3'
(R):5'- AGGATCAAGACTCAGGCTAGAC -3'

Sequencing Primer
(F):5'- GAGTGAGATTGCTACCTTTTTGAAAG -3'
(R):5'- GAAGACCCTGAAGACAGC -3'
Posted On2016-10-24