Incidental Mutation 'R5548:Pcdh8'
ID435007
Institutional Source Beutler Lab
Gene Symbol Pcdh8
Ensembl Gene ENSMUSG00000036422
Gene Nameprotocadherin 8
Synonyms1700080P15Rik, Papc
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location79766775-79771312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79767502 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1028 (T1028A)
Ref Sequence ENSEMBL: ENSMUSP00000045333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039568] [ENSMUST00000195355]
Predicted Effect probably damaging
Transcript: ENSMUST00000039568
AA Change: T1028A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045333
Gene: ENSMUSG00000036422
AA Change: T1028A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 782 802 N/A INTRINSIC
low complexity region 828 860 N/A INTRINSIC
low complexity region 910 933 N/A INTRINSIC
low complexity region 974 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195034
Predicted Effect possibly damaging
Transcript: ENSMUST00000195355
AA Change: T931A

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141417
Gene: ENSMUSG00000036422
AA Change: T931A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 813 836 N/A INTRINSIC
low complexity region 877 883 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a type I transmembrane protein composed of an extracellular domain including 6 cadherin ectodomains, a single-pass transmembrane domain and a cytoplasmic tail. Unlike classical cadherins, which are generally encoded by 15-17 exons, this gene includes only 3 exons with the first large exon encoding the extracellular and transmembrane region. Although this gene product is capable of homophilic interaction, it appears to affect cell-cell adhesion indirectly by initiating signaling events that regulate classical cadherin-mediated adhesion. Based on studies on this protein and its orthologs, this protocadherin mainly functions in developing embryos and the central nervous system, but can also function as a tumor suppressor. Alternative splicing yielding isoforms with unique cytoplasmic tails has been reported. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice are viable and fertile, and do not exhibit any gross skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Pcdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pcdh8 APN 14 79769246 missense probably damaging 0.99
IGL02611:Pcdh8 APN 14 79767667 missense probably benign 0.00
R0094:Pcdh8 UTSW 14 79768148 missense probably damaging 1.00
R0118:Pcdh8 UTSW 14 79767408 missense probably damaging 1.00
R0558:Pcdh8 UTSW 14 79770076 missense probably damaging 1.00
R0681:Pcdh8 UTSW 14 79769960 missense probably benign
R0718:Pcdh8 UTSW 14 79770691 missense possibly damaging 0.49
R1281:Pcdh8 UTSW 14 79767726 missense probably damaging 1.00
R1487:Pcdh8 UTSW 14 79769547 missense probably damaging 1.00
R1511:Pcdh8 UTSW 14 79769389 missense possibly damaging 0.46
R1552:Pcdh8 UTSW 14 79770607 missense probably benign 0.20
R1556:Pcdh8 UTSW 14 79770403 missense probably damaging 1.00
R1659:Pcdh8 UTSW 14 79768134 missense probably damaging 1.00
R2062:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2063:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2068:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2920:Pcdh8 UTSW 14 79768714 missense possibly damaging 0.88
R3970:Pcdh8 UTSW 14 79770266 missense possibly damaging 0.78
R4113:Pcdh8 UTSW 14 79767513 missense probably damaging 1.00
R4771:Pcdh8 UTSW 14 79768270 missense possibly damaging 0.48
R4840:Pcdh8 UTSW 14 79770868 missense possibly damaging 0.67
R5169:Pcdh8 UTSW 14 79767655 missense probably benign 0.09
R5187:Pcdh8 UTSW 14 79770154 missense probably damaging 0.99
R5415:Pcdh8 UTSW 14 79770248 nonsense probably null
R5749:Pcdh8 UTSW 14 79770085 missense probably damaging 1.00
R5778:Pcdh8 UTSW 14 79770757 missense probably damaging 1.00
R5795:Pcdh8 UTSW 14 79770980 missense possibly damaging 0.95
R6313:Pcdh8 UTSW 14 79767651 missense probably benign 0.02
R7472:Pcdh8 UTSW 14 79771251 utr 5 prime probably null
R7540:Pcdh8 UTSW 14 79771103 missense probably benign
R7653:Pcdh8 UTSW 14 79767646 missense probably benign 0.01
R7751:Pcdh8 UTSW 14 79770703 missense probably damaging 0.96
R7836:Pcdh8 UTSW 14 79768661 missense possibly damaging 0.73
R8281:Pcdh8 UTSW 14 79769479 missense probably damaging 0.98
R8365:Pcdh8 UTSW 14 79770986 missense probably damaging 1.00
Z1176:Pcdh8 UTSW 14 79769077 missense probably benign 0.01
Z1177:Pcdh8 UTSW 14 79769881 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AACTTAGGGACGTGTCAGGG -3'
(R):5'- AGGTCATTCTGATCGCTGC -3'

Sequencing Primer
(F):5'- GTGACCTGTATATGTGTGTGAAGAC -3'
(R):5'- CATTCTGATCGCTGCTGGAGC -3'
Posted On2016-10-24