Incidental Mutation 'R5548:Cdh12'
List |< first << previous [record 4 of 45] next >> last >|
ID435008
Institutional Source Beutler Lab
Gene Symbol Cdh12
Ensembl Gene ENSMUSG00000040452
Gene Namecadherin 12
SynonymsBr-cadherin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location20449265-21589533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21492654 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 253 (T253I)
Ref Sequence ENSEMBL: ENSMUSP00000153750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075132] [ENSMUST00000227496]
Predicted Effect probably damaging
Transcript: ENSMUST00000075132
AA Change: T253I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074632
Gene: ENSMUSG00000040452
AA Change: T253I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 77 158 5.18e-18 SMART
CA 182 267 4.4e-30 SMART
CA 291 383 2.42e-18 SMART
CA 406 487 7.55e-20 SMART
CA 510 597 9.3e-2 SMART
transmembrane domain 615 637 N/A INTRINSIC
Pfam:Cadherin_C 640 784 1.7e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227496
AA Change: T253I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in both the excitatory and inhibitory neurons in various areas of the adult central nervous system including the cerebellum, neocortex, hippocampus and in different subcortical nuclei. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Cdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Cdh12 APN 15 21237903 missense probably damaging 0.98
IGL01414:Cdh12 APN 15 21492689 missense probably damaging 1.00
IGL02088:Cdh12 APN 15 21480339 nonsense probably null
IGL02894:Cdh12 APN 15 21586294 missense probably damaging 1.00
IGL03008:Cdh12 APN 15 21480330 missense probably damaging 0.98
IGL03271:Cdh12 APN 15 21586453 missense probably benign 0.19
IGL03402:Cdh12 APN 15 21583740 missense probably benign 0.08
R0042:Cdh12 UTSW 15 21537677 splice site probably benign
R0126:Cdh12 UTSW 15 21583945 missense probably benign
R0239:Cdh12 UTSW 15 21586407 missense probably damaging 1.00
R0239:Cdh12 UTSW 15 21586407 missense probably damaging 1.00
R0335:Cdh12 UTSW 15 21578549 critical splice donor site probably null
R0421:Cdh12 UTSW 15 21480224 critical splice acceptor site probably null
R0918:Cdh12 UTSW 15 21492599 missense probably damaging 0.99
R0972:Cdh12 UTSW 15 21237764 missense probably benign 0.27
R1014:Cdh12 UTSW 15 21492620 missense probably damaging 0.97
R1304:Cdh12 UTSW 15 21583937 missense probably benign 0.10
R1677:Cdh12 UTSW 15 21520405 missense probably damaging 0.99
R1735:Cdh12 UTSW 15 21520366 missense probably damaging 1.00
R1916:Cdh12 UTSW 15 21520250 splice site probably null
R1950:Cdh12 UTSW 15 21237879 missense probably damaging 1.00
R2059:Cdh12 UTSW 15 21583740 missense probably benign 0.08
R2157:Cdh12 UTSW 15 21583787 missense possibly damaging 0.84
R2404:Cdh12 UTSW 15 21537634 missense probably damaging 1.00
R3625:Cdh12 UTSW 15 21358756 missense probably damaging 1.00
R3703:Cdh12 UTSW 15 21583826 missense probably damaging 0.97
R3704:Cdh12 UTSW 15 21583826 missense probably damaging 0.97
R3743:Cdh12 UTSW 15 21537659 missense probably damaging 0.98
R3771:Cdh12 UTSW 15 21578554 splice site probably benign
R3780:Cdh12 UTSW 15 21585977 splice site probably null
R4750:Cdh12 UTSW 15 21583808 missense possibly damaging 0.59
R5373:Cdh12 UTSW 15 21583912 missense probably damaging 1.00
R5374:Cdh12 UTSW 15 21583912 missense probably damaging 1.00
R5443:Cdh12 UTSW 15 21237849 missense probably benign 0.01
R5746:Cdh12 UTSW 15 21358724 missense probably null 1.00
R5960:Cdh12 UTSW 15 21492476 splice site probably null
R6248:Cdh12 UTSW 15 21237714 missense possibly damaging 0.82
R6379:Cdh12 UTSW 15 21492657 missense probably benign 0.02
R6419:Cdh12 UTSW 15 21520397 missense probably damaging 0.99
R6561:Cdh12 UTSW 15 21492594 missense probably damaging 1.00
R6901:Cdh12 UTSW 15 21583786 missense probably benign 0.01
R7025:Cdh12 UTSW 15 21358814 missense probably damaging 1.00
R7070:Cdh12 UTSW 15 21583829 missense probably benign 0.38
R7508:Cdh12 UTSW 15 21583765 missense probably benign
R8126:Cdh12 UTSW 15 21558307 missense probably benign 0.02
R8307:Cdh12 UTSW 15 21358863 missense probably benign
R8307:Cdh12 UTSW 15 21358864 missense probably damaging 1.00
X0065:Cdh12 UTSW 15 21358765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTTCCAGTCTAATTAGGTCAG -3'
(R):5'- AAAATATTGCAGGGTGTGTACG -3'

Sequencing Primer
(F):5'- GTTCCAGTCTAATTAGGTCAGGAGAC -3'
(R):5'- CAATTAGAGCGTGGATCTGGATG -3'
Posted On2016-10-24