Incidental Mutation 'R0190:B230118H07Rik'
ID43501
Institutional Source Beutler Lab
Gene Symbol B230118H07Rik
Ensembl Gene ENSMUSG00000027165
Gene NameRIKEN cDNA B230118H07 gene
SynonymsNWC
MMRRC Submission 038451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0190 (G1)
Quality Score84
Status Not validated
Chromosome2
Chromosomal Location101560781-101649532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101586430 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 58 (S58L)
Ref Sequence ENSEMBL: ENSMUSP00000097274 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000090513
AA Change: S58L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000099682
AA Change: S58L

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000111231
AA Change: S58L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000128898
AA Change: S58L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect unknown
Transcript: ENSMUST00000136601
AA Change: S24L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138903
Predicted Effect probably benign
Transcript: ENSMUST00000160037
AA Change: S58L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000160722
AA Change: S58L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 91.6%
  • 20x: 72.5%
Validation Efficiency 75% (45/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified as a cellular interacting partner of non-structural protein 10 of the severe acute respiratory syndrome coronavirus (SARS-CoV). The encoded protein may function as a negative regulator of transcription. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous deletion of one of two alternative first exons and its promoter has no obvious phenotypic effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,392 probably null Het
Aff2 CA CAAA X: 69,849,105 probably null Het
Ankrd34a A G 3: 96,597,789 D103G probably damaging Het
Atp1b2 T C 11: 69,601,562 D224G probably damaging Het
Atxn10 A G 15: 85,336,529 D22G possibly damaging Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Caskin1 C T 17: 24,504,622 L795F possibly damaging Het
Cdk12 T C 11: 98,241,831 probably null Het
Crtc2 A G 3: 90,259,409 H91R probably damaging Het
Dbt A G 3: 116,539,087 probably null Het
Dda1 C A 8: 71,472,233 Y41* probably null Het
Dnah2 T A 11: 69,435,249 D3692V probably damaging Het
Dpep1 A G 8: 123,200,708 T334A probably benign Het
Enthd1 C T 15: 80,534,494 probably null Het
Fpr-rs6 T A 17: 20,182,479 I207F probably benign Het
Fsip2 T A 2: 82,985,177 S3751R possibly damaging Het
Gigyf2 A T 1: 87,428,688 probably benign Het
Gtf3c4 C A 2: 28,840,128 D34Y probably benign Het
Igfn1 A T 1: 135,962,052 V2419E probably damaging Het
Kank1 A T 19: 25,409,283 I79L probably benign Het
Kif21b A G 1: 136,171,219 H1415R probably benign Het
Mad2l1 T C 6: 66,539,878 S185P possibly damaging Het
Mettl18 A G 1: 163,996,422 E104G probably damaging Het
Mrgprb2 G A 7: 48,552,777 H67Y possibly damaging Het
Mrgprd G A 7: 145,321,702 M103I probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Nucks1 A G 1: 131,924,591 D60G probably damaging Het
Olfr1245 T A 2: 89,574,958 Y256F probably damaging Het
Olfr275 G C 4: 52,825,613 W72S probably damaging Het
Olfr978 A G 9: 39,994,544 I245V probably benign Het
Paqr8 A G 1: 20,935,047 T142A probably benign Het
Pdss1 T C 2: 22,906,831 S119P probably damaging Het
Plcl2 A G 17: 50,607,643 D560G probably benign Het
Ppm1b T A 17: 84,994,103 V137E probably damaging Het
Ppp1r16b A C 2: 158,696,063 K35Q probably damaging Het
Prkd2 A T 7: 16,869,890 E832V probably damaging Het
Rab34 G T 11: 78,191,406 K191N possibly damaging Het
Rad51ap2 A C 12: 11,458,539 T821P probably benign Het
Rbm19 A G 5: 120,144,046 T823A probably benign Het
Rpf2 T G 10: 40,227,601 H106P probably damaging Het
Schip1 A G 3: 68,625,844 M453V probably benign Het
Sema5a T A 15: 32,562,774 N310K possibly damaging Het
Sf3b1 T C 1: 54,990,306 D1179G probably damaging Het
Skint2 A T 4: 112,616,532 T4S possibly damaging Het
Slc22a5 A T 11: 53,869,415 Y358* probably null Het
Slc34a1 T C 13: 55,409,101 M251T probably benign Het
Slc44a5 A G 3: 154,239,118 D124G probably null Het
Slc9b1 G A 3: 135,357,673 E73K unknown Het
Ssbp2 T C 13: 91,669,710 L156P probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Trim47 A G 11: 116,106,227 V568A probably damaging Het
Ttn A T 2: 76,887,980 probably benign Het
Ttpa A T 4: 20,021,260 I74F probably damaging Het
Vmn2r52 T C 7: 10,171,388 I175V probably benign Het
Wrn C T 8: 33,240,983 C1350Y probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp422 A T 6: 116,626,611 D142E probably damaging Het
Zfp473 A T 7: 44,733,188 C574S probably damaging Het
Zfp638 T A 6: 83,928,964 M37K probably damaging Het
Zfp976 C A 7: 42,642,524 probably benign Het
Other mutations in B230118H07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03347:B230118H07Rik APN 2 101583519 critical splice donor site probably null
IGL03384:B230118H07Rik APN 2 101585263 missense probably benign 0.00
R0436:B230118H07Rik UTSW 2 101610519 splice site probably benign
R0591:B230118H07Rik UTSW 2 101576117 missense probably benign 0.14
R0880:B230118H07Rik UTSW 2 101576110 missense probably benign 0.32
R1608:B230118H07Rik UTSW 2 101610571 missense probably damaging 1.00
R6008:B230118H07Rik UTSW 2 101583553 missense possibly damaging 0.52
R6060:B230118H07Rik UTSW 2 101610605 missense probably benign 0.06
R6155:B230118H07Rik UTSW 2 101576010 critical splice donor site probably null
R6805:B230118H07Rik UTSW 2 101566459 missense probably benign 0.29
R7209:B230118H07Rik UTSW 2 101566382 makesense probably null
R7258:B230118H07Rik UTSW 2 101610592 missense probably null 0.96
R7680:B230118H07Rik UTSW 2 101610556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGCTTTCTTCTTCTCCAAGCTGTT -3'
(R):5'- ccaccaccaccACCCAGTGA -3'

Sequencing Primer
(F):5'- TCTTCTCCAAGCTGTTTCTATAAATG -3'
(R):5'- GGCATACATTGCTTCCATATGAG -3'
Posted On2013-05-24