Incidental Mutation 'R5548:Slc38a1'
ID 435010
Institutional Source Beutler Lab
Gene Symbol Slc38a1
Ensembl Gene ENSMUSG00000023169
Gene Name solute carrier family 38, member 1
Synonyms NAT2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R5548 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 96571418-96642913 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 96590474 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 143 (G143S)
Ref Sequence ENSEMBL: ENSMUSP00000097833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088452] [ENSMUST00000088454] [ENSMUST00000100262]
AlphaFold Q8K2P7
Predicted Effect probably damaging
Transcript: ENSMUST00000088452
AA Change: G143S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085799
Gene: ENSMUSG00000023169
AA Change: G143S

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 6.1e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088454
AA Change: G143S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085801
Gene: ENSMUSG00000023169
AA Change: G143S

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100262
AA Change: G143S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097833
Gene: ENSMUSG00000023169
AA Change: G143S

DomainStartEndE-ValueType
Pfam:Aa_trans 69 473 5.8e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230756
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Amino acid transporters play essential roles in the uptake of nutrients, production of energy, chemical metabolism, detoxification, and neurotransmitter cycling. SLC38A1 is an important transporter of glutamine, an intermediate in the detoxification of ammonia and the production of urea. Glutamine serves as a precursor for the synaptic transmitter, glutamate (Gu et al., 2001 [PubMed 11325958]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Slc38a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Slc38a1 APN 15 96585623 missense possibly damaging 0.89
IGL01376:Slc38a1 APN 15 96585556 missense probably damaging 1.00
IGL01920:Slc38a1 APN 15 96586897 missense probably benign
IGL01993:Slc38a1 APN 15 96624046 missense probably damaging 1.00
IGL02201:Slc38a1 APN 15 96578798 missense probably damaging 1.00
IGL03074:Slc38a1 APN 15 96592524 missense possibly damaging 0.72
IGL03370:Slc38a1 APN 15 96579347 missense possibly damaging 0.93
R0918:Slc38a1 UTSW 15 96609862 missense probably damaging 1.00
R1506:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R1510:Slc38a1 UTSW 15 96609860 missense probably damaging 1.00
R1713:Slc38a1 UTSW 15 96578760 missense probably damaging 1.00
R1721:Slc38a1 UTSW 15 96587135 missense probably damaging 1.00
R1867:Slc38a1 UTSW 15 96587135 missense probably damaging 1.00
R4254:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R4255:Slc38a1 UTSW 15 96585550 missense probably benign 0.04
R4754:Slc38a1 UTSW 15 96576782 missense probably damaging 0.98
R5610:Slc38a1 UTSW 15 96616141 critical splice donor site probably null
R6235:Slc38a1 UTSW 15 96578792 missense probably benign 0.36
R6288:Slc38a1 UTSW 15 96586878 missense probably benign 0.12
R7904:Slc38a1 UTSW 15 96624040 missense possibly damaging 0.95
R8195:Slc38a1 UTSW 15 96592566 missense probably benign 0.27
R8876:Slc38a1 UTSW 15 96616210 missense possibly damaging 0.93
R9515:Slc38a1 UTSW 15 96590084 missense probably damaging 1.00
R9555:Slc38a1 UTSW 15 96588979 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GACACTCGCTGTTCGGATTG -3'
(R):5'- TGAAACCTGCTTGACCAAGG -3'

Sequencing Primer
(F):5'- CGCTGTTCGGATTGCGTTAAATC -3'
(R):5'- GCACGTGACATTTAGAGTCAAGGTTC -3'
Posted On 2016-10-24