Incidental Mutation 'R5548:Tmem63b'
List |< first << previous [record 37 of 45] next >> last >|
ID435014
Institutional Source Beutler Lab
Gene Symbol Tmem63b
Ensembl Gene ENSMUSG00000036026
Gene Nametransmembrane protein 63b
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45660171-45686905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45664958 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 523 (I523T)
Ref Sequence ENSEMBL: ENSMUSP00000109151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113523] [ENSMUST00000145873]
Predicted Effect probably damaging
Transcript: ENSMUST00000113523
AA Change: I523T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109151
Gene: ENSMUSG00000036026
AA Change: I523T

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
Pfam:RSN1_TM 101 226 2.5e-23 PFAM
Pfam:PHM7_cyt 274 344 9.1e-10 PFAM
Pfam:RSN1_7TM 362 706 5.3e-96 PFAM
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129177
Predicted Effect probably benign
Transcript: ENSMUST00000145873
SMART Domains Protein: ENSMUSP00000121681
Gene: ENSMUSG00000036026

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:RSN1_TM 87 213 1.1e-24 PFAM
Blast:RRM 228 308 3e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156224
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc16a5 A T 11: 115,469,804 Y271F probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Tmem63b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Tmem63b APN 17 45663571 missense probably damaging 1.00
IGL02486:Tmem63b APN 17 45673983 missense probably damaging 0.97
IGL02519:Tmem63b APN 17 45665208 missense possibly damaging 0.46
IGL02893:Tmem63b APN 17 45661900 missense probably damaging 1.00
IGL03137:Tmem63b APN 17 45664995 missense probably damaging 0.98
R0211:Tmem63b UTSW 17 45661913 missense probably benign 0.00
R0211:Tmem63b UTSW 17 45661913 missense probably benign 0.00
R0276:Tmem63b UTSW 17 45675373 splice site probably benign
R0441:Tmem63b UTSW 17 45666315 critical splice donor site probably null
R0729:Tmem63b UTSW 17 45674134 missense probably damaging 1.00
R0749:Tmem63b UTSW 17 45666115 missense possibly damaging 0.89
R0834:Tmem63b UTSW 17 45660944 missense possibly damaging 0.93
R0835:Tmem63b UTSW 17 45660944 missense possibly damaging 0.93
R0865:Tmem63b UTSW 17 45661519 missense probably benign 0.02
R1144:Tmem63b UTSW 17 45666427 missense probably benign 0.07
R1448:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1468:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1468:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1538:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1853:Tmem63b UTSW 17 45661297 missense possibly damaging 0.68
R1935:Tmem63b UTSW 17 45678961 critical splice donor site probably null
R2078:Tmem63b UTSW 17 45663536 missense possibly damaging 0.91
R2518:Tmem63b UTSW 17 45666154 missense probably benign
R3911:Tmem63b UTSW 17 45677958 missense probably damaging 1.00
R5093:Tmem63b UTSW 17 45660874 missense probably damaging 1.00
R5186:Tmem63b UTSW 17 45661477 missense possibly damaging 0.68
R5364:Tmem63b UTSW 17 45664727 unclassified probably benign
R5396:Tmem63b UTSW 17 45669962 missense possibly damaging 0.72
R5582:Tmem63b UTSW 17 45667763 missense probably benign
R5998:Tmem63b UTSW 17 45670000 missense possibly damaging 0.94
R6198:Tmem63b UTSW 17 45661516 missense probably benign 0.00
R6656:Tmem63b UTSW 17 45667708 missense probably benign
R6808:Tmem63b UTSW 17 45660808 missense probably benign 0.13
R6967:Tmem63b UTSW 17 45666632 missense probably benign 0.00
R7089:Tmem63b UTSW 17 45667783 missense probably benign 0.00
R7181:Tmem63b UTSW 17 45673168 missense probably benign 0.00
R7214:Tmem63b UTSW 17 45661822 missense probably benign 0.02
R7267:Tmem63b UTSW 17 45666122 missense probably benign
R7323:Tmem63b UTSW 17 45660847 missense possibly damaging 0.86
R7346:Tmem63b UTSW 17 45666591 missense probably benign
R8281:Tmem63b UTSW 17 45660796 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCTGGTCACTCACTCAAAC -3'
(R):5'- TTCGTTCTGAAGGTTCCCTG -3'

Sequencing Primer
(F):5'- TTCTTGTCAAAGAGCCAGCG -3'
(R):5'- TGAAGGTTCCCTGCCCTG -3'
Posted On2016-10-24