Incidental Mutation 'R5549:Sox2'
ID435024
Institutional Source Beutler Lab
Gene Symbol Sox2
Ensembl Gene ENSMUSG00000074637
Gene NameSRY (sex determining region Y)-box 2
Synonymsysb, Sox-2, lcc
MMRRC Submission 043106-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5549 (G1)
Quality Score157
Status Not validated
Chromosome3
Chromosomal Location34650405-34652461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 34650993 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 193 (A193G)
Ref Sequence ENSEMBL: ENSMUSP00000096755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099151]
Predicted Effect probably benign
Transcript: ENSMUST00000099151
AA Change: A193G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000096755
Gene: ENSMUSG00000074637
AA Change: A193G

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
HMG 42 112 1.8e-28 SMART
low complexity region 137 156 N/A INTRINSIC
low complexity region 248 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200414
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in a similar gene in human have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (Sox2ot). [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations implant but fail to develop an egg cylinder or epiblast, and die shortly thereafter. Other mutations that affect only regulatory elements show circling behavior and deafness, inner ear defects, and a yellow coat color. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,036 E324G possibly damaging Het
Acad8 C T 9: 26,985,551 R204Q probably damaging Het
Adgrg7 T G 16: 56,750,427 T413P probably damaging Het
Ankrd11 A G 8: 122,890,378 I2224T probably benign Het
Arhgap23 A G 11: 97,466,568 D964G probably damaging Het
Atf6b A G 17: 34,651,683 D367G probably damaging Het
Axdnd1 A G 1: 156,398,534 L131P probably damaging Het
BC003331 A G 1: 150,372,158 S325P possibly damaging Het
Bmp8b T C 4: 123,124,485 V383A probably damaging Het
C5ar2 A G 7: 16,236,943 V353A probably damaging Het
Ccr5 C A 9: 124,125,371 A337E probably benign Het
Cftr G A 6: 18,227,954 V382I probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Cyp2d12 A G 15: 82,556,297 T96A probably benign Het
Diaph3 T G 14: 86,978,670 I465L probably benign Het
Fabp3 A G 4: 130,315,225 *134W probably null Het
Fam213a T C 14: 41,004,056 K44E possibly damaging Het
Fgf22 G T 10: 79,756,862 M130I probably damaging Het
Flnc G A 6: 29,453,691 V1792M probably damaging Het
Grik3 G A 4: 125,686,045 A528T possibly damaging Het
Hecw2 G A 1: 53,925,691 R659W possibly damaging Het
Hmbs C T 9: 44,339,477 probably null Het
Ift122 T G 6: 115,892,022 L490R probably damaging Het
Igkv4-63 T C 6: 69,378,132 H55R probably damaging Het
Itga4 A T 2: 79,256,267 N96I probably damaging Het
Kcna7 A T 7: 45,406,639 H93L probably damaging Het
Klhdc7b A G 15: 89,387,359 I815V probably benign Het
Lcmt1 G A 7: 123,428,107 E298K probably damaging Het
Ly6g6f A G 17: 35,083,357 V68A possibly damaging Het
Map3k8 C T 18: 4,340,762 C184Y probably damaging Het
Mcemp1 A G 8: 3,668,340 T183A possibly damaging Het
Mobp T G 9: 120,167,810 S2R probably damaging Het
Mprip A G 11: 59,760,818 S1783G probably benign Het
Mterf3 C A 13: 66,928,257 A129S probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nr2c1 A G 10: 94,167,696 T239A probably benign Het
Olfr541 A G 7: 140,704,799 probably null Het
Oplah G A 15: 76,298,266 A963V probably damaging Het
Parp14 C T 16: 35,841,135 S1481N probably benign Het
Rictor C T 15: 6,786,910 T1221M probably damaging Het
Rpe G A 1: 66,716,004 D182N probably damaging Het
Slc24a3 C A 2: 145,606,864 P443T probably damaging Het
Slc25a47 T C 12: 108,856,217 *311Q probably null Het
Svep1 T C 4: 58,057,954 S3284G probably benign Het
Zfp369 A T 13: 65,297,380 H779L probably damaging Het
Zfp513 A T 5: 31,200,603 L144Q possibly damaging Het
Zfp526 T C 7: 25,225,684 F456S possibly damaging Het
Zfp791 C T 8: 85,110,206 G343D probably damaging Het
Zfp941 A C 7: 140,808,108 I664S possibly damaging Het
Zkscan3 A G 13: 21,394,063 V189A probably damaging Het
Other mutations in Sox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02578:Sox2 APN 3 34650596 missense probably benign 0.37
IGL03397:Sox2 APN 3 34650537 missense probably damaging 0.99
R1164:Sox2 UTSW 3 34650699 missense probably damaging 1.00
R1667:Sox2 UTSW 3 34650419 missense probably damaging 1.00
R1829:Sox2 UTSW 3 34650741 missense probably damaging 0.99
R1925:Sox2 UTSW 3 34650671 nonsense probably null
R2066:Sox2 UTSW 3 34651307 missense possibly damaging 0.63
R4170:Sox2 UTSW 3 34650554 missense probably damaging 0.99
R4585:Sox2 UTSW 3 34651044 missense probably benign 0.02
R4586:Sox2 UTSW 3 34651044 missense probably benign 0.02
R4703:Sox2 UTSW 3 34650713 missense probably damaging 1.00
R5509:Sox2 UTSW 3 34650789 missense probably damaging 0.98
R5637:Sox2 UTSW 3 34650528 missense probably benign 0.03
R6494:Sox2 UTSW 3 34651097 missense probably benign 0.01
R7117:Sox2 UTSW 3 34650926 missense possibly damaging 0.95
R7210:Sox2 UTSW 3 34651157 missense probably damaging 1.00
R7365:Sox2 UTSW 3 34650972 missense possibly damaging 0.60
R7798:Sox2 UTSW 3 34650642 missense probably damaging 0.96
R7801:Sox2 UTSW 3 34650642 missense probably damaging 0.96
X0024:Sox2 UTSW 3 34650689 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAAGTACACGCTTCCCGGAG -3'
(R):5'- ATGCTGATCATGTCCCGGAG -3'

Sequencing Primer
(F):5'- ATGGACAGCTACGCGCACATGA -3'
(R):5'- TGGGAGGAAGAGGTAACCAC -3'
Posted On2016-10-24