Mutagenetix > Incidental Mutation

Incidental Mutation 'R5549:Ift122'

435033

Institutional Source

Beutler Lab

Gene Symbol

Ift122

Ensembl Gene

ENSMUSG00000030323

Gene Name

intraflagellar transport 122

Synonyms

C86139, sopb, Wdr10

MMRRC Submission

043106-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5549 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115853470-115926699 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 115892022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 490 (L490R)

Ref Sequence

ENSEMBL: ENSMUSP00000108547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]

AlphaFold

Q6NWV3

Predicted Effect

probably damaging
Transcript: ENSMUST00000038234
AA Change: L490R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: L490R

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112923
AA Change: L549R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: L549R

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
Blast:WD40	163	267	3e-46	BLAST
WD40	269	308	1.91e1	SMART
WD40	310	349	3.45e-3	SMART
WD40	507	542	1.43e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112925
AA Change: L490R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: L490R

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
WD40	122	160	1.43e0	SMART
WD40	162	208	2.29e1	SMART
WD40	210	249	1.91e1	SMART
WD40	251	290	3.45e-3	SMART
WD40	448	483	1.43e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138113

Predicted Effect

probably benign
Transcript: ENSMUST00000141305

SMART Domains

Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

Domain	Start	End	E-Value	Type
WD40	1	39	7.1e1	SMART
WD40	42	81	7.16e-10	SMART
WD40	83	120	1.54e0	SMART
low complexity region	124	134	N/A	INTRINSIC
low complexity region	162	176	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146950

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149083

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152092

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,663,036	E324G	possibly damaging	Het
Acad8	C	T	9: 26,985,551	R204Q	probably damaging	Het
Adgrg7	T	G	16: 56,750,427	T413P	probably damaging	Het
Ankrd11	A	G	8: 122,890,378	I2224T	probably benign	Het
Arhgap23	A	G	11: 97,466,568	D964G	probably damaging	Het
Atf6b	A	G	17: 34,651,683	D367G	probably damaging	Het
Axdnd1	A	G	1: 156,398,534	L131P	probably damaging	Het
BC003331	A	G	1: 150,372,158	S325P	possibly damaging	Het
Bmp8b	T	C	4: 123,124,485	V383A	probably damaging	Het
C5ar2	A	G	7: 16,236,943	V353A	probably damaging	Het
Ccr5	C	A	9: 124,125,371	A337E	probably benign	Het
Cftr	G	A	6: 18,227,954	V382I	probably benign	Het
Csmd3	G	C	15: 48,185,357	S446C	probably damaging	Het
Cyp2d12	A	G	15: 82,556,297	T96A	probably benign	Het
Diaph3	T	G	14: 86,978,670	I465L	probably benign	Het
Fabp3	A	G	4: 130,315,225	*134W	probably null	Het
Fam213a	T	C	14: 41,004,056	K44E	possibly damaging	Het
Fgf22	G	T	10: 79,756,862	M130I	probably damaging	Het
Flnc	G	A	6: 29,453,691	V1792M	probably damaging	Het
Grik3	G	A	4: 125,686,045	A528T	possibly damaging	Het
Hecw2	G	A	1: 53,925,691	R659W	possibly damaging	Het
Hmbs	C	T	9: 44,339,477		probably null	Het
Igkv4-63	T	C	6: 69,378,132	H55R	probably damaging	Het
Itga4	A	T	2: 79,256,267	N96I	probably damaging	Het
Kcna7	A	T	7: 45,406,639	H93L	probably damaging	Het
Klhdc7b	A	G	15: 89,387,359	I815V	probably benign	Het
Lcmt1	G	A	7: 123,428,107	E298K	probably damaging	Het
Ly6g6f	A	G	17: 35,083,357	V68A	possibly damaging	Het
Map3k8	C	T	18: 4,340,762	C184Y	probably damaging	Het
Mcemp1	A	G	8: 3,668,340	T183A	possibly damaging	Het
Mobp	T	G	9: 120,167,810	S2R	probably damaging	Het
Mprip	A	G	11: 59,760,818	S1783G	probably benign	Het
Mterf3	C	A	13: 66,928,257	A129S	probably benign	Het
Nfkb2	G	T	19: 46,307,567	E170D	probably benign	Het
Nr2c1	A	G	10: 94,167,696	T239A	probably benign	Het
Olfr541	A	G	7: 140,704,799		probably null	Het
Oplah	G	A	15: 76,298,266	A963V	probably damaging	Het
Parp14	C	T	16: 35,841,135	S1481N	probably benign	Het
Rictor	C	T	15: 6,786,910	T1221M	probably damaging	Het
Rpe	G	A	1: 66,716,004	D182N	probably damaging	Het
Slc24a3	C	A	2: 145,606,864	P443T	probably damaging	Het
Slc25a47	T	C	12: 108,856,217	*311Q	probably null	Het
Sox2	C	G	3: 34,650,993	A193G	probably benign	Het
Svep1	T	C	4: 58,057,954	S3284G	probably benign	Het
Zfp369	A	T	13: 65,297,380	H779L	probably damaging	Het
Zfp513	A	T	5: 31,200,603	L144Q	possibly damaging	Het
Zfp526	T	C	7: 25,225,684	F456S	possibly damaging	Het
Zfp791	C	T	8: 85,110,206	G343D	probably damaging	Het
Zfp941	A	C	7: 140,808,108	I664S	possibly damaging	Het
Zkscan3	A	G	13: 21,394,063	V189A	probably damaging	Het

Other mutations in Ift122

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Ift122	APN	6	115917057	missense	probably benign	0.10
IGL00783:Ift122	APN	6	115905902	missense	probably benign
IGL00784:Ift122	APN	6	115905902	missense	probably benign
IGL00799:Ift122	APN	6	115877536	missense	probably damaging	1.00
IGL00908:Ift122	APN	6	115913909	missense	probably benign	0.00
IGL01012:Ift122	APN	6	115899491	missense	probably damaging	0.99
IGL01444:Ift122	APN	6	115884379	missense	probably benign	0.08
IGL01451:Ift122	APN	6	115912604	critical splice donor site	probably null
IGL01940:Ift122	APN	6	115887371	splice site	probably benign
IGL02089:Ift122	APN	6	115925437	missense	probably benign	0.00
IGL02331:Ift122	APN	6	115887324	missense	probably damaging	1.00
IGL02929:Ift122	APN	6	115902877	missense	probably damaging	1.00
IGL03169:Ift122	APN	6	115905961	splice site	probably benign
PIT1430001:Ift122	UTSW	6	115925744	splice site	probably benign
R0158:Ift122	UTSW	6	115924484	splice site	probably benign
R0496:Ift122	UTSW	6	115905902	missense	probably benign
R1065:Ift122	UTSW	6	115875325	splice site	probably null
R1670:Ift122	UTSW	6	115923883	missense	probably benign	0.05
R1861:Ift122	UTSW	6	115891928	missense	probably damaging	1.00
R1889:Ift122	UTSW	6	115894421	critical splice donor site	probably null
R1990:Ift122	UTSW	6	115924367	missense	probably damaging	1.00
R2362:Ift122	UTSW	6	115884350	missense	probably damaging	0.99
R2385:Ift122	UTSW	6	115912522	missense	probably benign	0.21
R3734:Ift122	UTSW	6	115925501	splice site	probably benign
R3800:Ift122	UTSW	6	115925906	missense	probably benign	0.03
R3981:Ift122	UTSW	6	115913921	missense	probably benign	0.02
R4289:Ift122	UTSW	6	115923891	missense	probably damaging	1.00
R4545:Ift122	UTSW	6	115890588	missense	probably damaging	1.00
R4546:Ift122	UTSW	6	115890588	missense	probably damaging	1.00
R4641:Ift122	UTSW	6	115888765	nonsense	probably null
R4815:Ift122	UTSW	6	115881556	missense	possibly damaging	0.95
R4854:Ift122	UTSW	6	115862746	missense	possibly damaging	0.61
R4928:Ift122	UTSW	6	115915858	utr 3 prime	probably benign
R5021:Ift122	UTSW	6	115864372	missense	probably benign	0.41
R5121:Ift122	UTSW	6	115912534	missense	probably benign	0.04
R5200:Ift122	UTSW	6	115920379	missense	probably damaging	0.99
R6111:Ift122	UTSW	6	115875286	missense	probably damaging	1.00
R6141:Ift122	UTSW	6	115916011	missense	probably damaging	0.99
R6766:Ift122	UTSW	6	115926243	missense	probably benign	0.15
R7379:Ift122	UTSW	6	115926302	missense	probably benign
R7402:Ift122	UTSW	6	115894322	missense	probably benign	0.00
R7436:Ift122	UTSW	6	115926302	missense	probably benign
R7437:Ift122	UTSW	6	115926302	missense	probably benign
R7438:Ift122	UTSW	6	115926302	missense	probably benign
R7517:Ift122	UTSW	6	115890582	missense	probably benign	0.37
R7978:Ift122	UTSW	6	115920352	missense	probably benign	0.37
R8492:Ift122	UTSW	6	115887005	missense	probably benign	0.02
R8493:Ift122	UTSW	6	115910331	missense	probably benign	0.01
R8669:Ift122	UTSW	6	115923291	missense	probably damaging	0.98
R8867:Ift122	UTSW	6	115880671	missense	probably damaging	1.00
R8887:Ift122	UTSW	6	115891919	missense	probably benign	0.00
R8947:Ift122	UTSW	6	115924407	missense	probably benign
R8978:Ift122	UTSW	6	115925808	missense	possibly damaging	0.78
R9149:Ift122	UTSW	6	115890531	missense	probably damaging	1.00
R9571:Ift122	UTSW	6	115880667	missense	possibly damaging	0.50
R9573:Ift122	UTSW	6	115880685	missense	probably benign
R9677:Ift122	UTSW	6	115920396	missense	probably benign	0.16
Z1176:Ift122	UTSW	6	115915994	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGGTTGCCGTGGTAACTC -3'
(R):5'- AACTGAGGTTACTTGCCCATCTTC -3'

Sequencing Primer
(F):5'- GCCGTGGTAACTCACACTTATTTC -3'
(R):5'- CTTCCTGAGAAGGAAACCAGTGC -3'

Posted On

2016-10-24