Incidental Mutation 'R5549:Olfr541'
ID 435039
Institutional Source Beutler Lab
Gene Symbol Olfr541
Ensembl Gene ENSMUSG00000057997
Gene Name olfactory receptor 541
Synonyms GA_x6K02T2PBJ9-42850324-42851256, MOR253-3
MMRRC Submission 043106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R5549 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140697267-140705606 bp(+) (GRCm38)
Type of Mutation splice site (161 bp from exon)
DNA Base Change (assembly) A to G at 140704799 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080681] [ENSMUST00000209857] [ENSMUST00000210357]
AlphaFold Q8VGM0
Predicted Effect probably benign
Transcript: ENSMUST00000080681
AA Change: I183V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000079508
Gene: ENSMUSG00000057997
AA Change: I183V

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 2.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 37 180 5e-8 PFAM
Pfam:7tm_1 43 292 1.2e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209857
Predicted Effect probably benign
Transcript: ENSMUST00000210357
AA Change: I183V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,036 E324G possibly damaging Het
Acad8 C T 9: 26,985,551 R204Q probably damaging Het
Adgrg7 T G 16: 56,750,427 T413P probably damaging Het
Ankrd11 A G 8: 122,890,378 I2224T probably benign Het
Arhgap23 A G 11: 97,466,568 D964G probably damaging Het
Atf6b A G 17: 34,651,683 D367G probably damaging Het
Axdnd1 A G 1: 156,398,534 L131P probably damaging Het
BC003331 A G 1: 150,372,158 S325P possibly damaging Het
Bmp8b T C 4: 123,124,485 V383A probably damaging Het
C5ar2 A G 7: 16,236,943 V353A probably damaging Het
Ccr5 C A 9: 124,125,371 A337E probably benign Het
Cftr G A 6: 18,227,954 V382I probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Cyp2d12 A G 15: 82,556,297 T96A probably benign Het
Diaph3 T G 14: 86,978,670 I465L probably benign Het
Fabp3 A G 4: 130,315,225 *134W probably null Het
Fam213a T C 14: 41,004,056 K44E possibly damaging Het
Fgf22 G T 10: 79,756,862 M130I probably damaging Het
Flnc G A 6: 29,453,691 V1792M probably damaging Het
Grik3 G A 4: 125,686,045 A528T possibly damaging Het
Hecw2 G A 1: 53,925,691 R659W possibly damaging Het
Hmbs C T 9: 44,339,477 probably null Het
Ift122 T G 6: 115,892,022 L490R probably damaging Het
Igkv4-63 T C 6: 69,378,132 H55R probably damaging Het
Itga4 A T 2: 79,256,267 N96I probably damaging Het
Kcna7 A T 7: 45,406,639 H93L probably damaging Het
Klhdc7b A G 15: 89,387,359 I815V probably benign Het
Lcmt1 G A 7: 123,428,107 E298K probably damaging Het
Ly6g6f A G 17: 35,083,357 V68A possibly damaging Het
Map3k8 C T 18: 4,340,762 C184Y probably damaging Het
Mcemp1 A G 8: 3,668,340 T183A possibly damaging Het
Mobp T G 9: 120,167,810 S2R probably damaging Het
Mprip A G 11: 59,760,818 S1783G probably benign Het
Mterf3 C A 13: 66,928,257 A129S probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nr2c1 A G 10: 94,167,696 T239A probably benign Het
Oplah G A 15: 76,298,266 A963V probably damaging Het
Parp14 C T 16: 35,841,135 S1481N probably benign Het
Rictor C T 15: 6,786,910 T1221M probably damaging Het
Rpe G A 1: 66,716,004 D182N probably damaging Het
Slc24a3 C A 2: 145,606,864 P443T probably damaging Het
Slc25a47 T C 12: 108,856,217 *311Q probably null Het
Sox2 C G 3: 34,650,993 A193G probably benign Het
Svep1 T C 4: 58,057,954 S3284G probably benign Het
Zfp369 A T 13: 65,297,380 H779L probably damaging Het
Zfp513 A T 5: 31,200,603 L144Q possibly damaging Het
Zfp526 T C 7: 25,225,684 F456S possibly damaging Het
Zfp791 C T 8: 85,110,206 G343D probably damaging Het
Zfp941 A C 7: 140,808,108 I664S possibly damaging Het
Zkscan3 A G 13: 21,394,063 V189A probably damaging Het
Other mutations in Olfr541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Olfr541 APN 7 140704437 missense probably damaging 1.00
IGL01872:Olfr541 APN 7 140704263 missense possibly damaging 0.59
IGL02814:Olfr541 APN 7 140705133 missense probably damaging 1.00
R0690:Olfr541 UTSW 7 140704787 missense possibly damaging 0.88
R1019:Olfr541 UTSW 7 140704494 missense probably damaging 1.00
R1665:Olfr541 UTSW 7 140704794 missense probably damaging 1.00
R1696:Olfr541 UTSW 7 140704496 nonsense probably null
R4065:Olfr541 UTSW 7 140704269 missense probably benign
R4517:Olfr541 UTSW 7 140705091 missense probably damaging 1.00
R6327:Olfr541 UTSW 7 140704703 missense probably damaging 1.00
R7288:Olfr541 UTSW 7 140705029 nonsense probably null
R7307:Olfr541 UTSW 7 140705147 missense probably benign 0.39
R7454:Olfr541 UTSW 7 140704634 missense probably damaging 1.00
R8725:Olfr541 UTSW 7 140704694 missense probably benign
R9404:Olfr541 UTSW 7 140704809 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCATCTTCTGAGCTGC -3'
(R):5'- TAGAAAAGGCCTTCCTCTTGC -3'

Sequencing Primer
(F):5'- CATGGCCTATGACCGCTATGTG -3'
(R):5'- GCCCTCAGCAGAACGCATG -3'
Posted On 2016-10-24