Incidental Mutation 'R0190:Slc9b1'
ID43504
Institutional Source Beutler Lab
Gene Symbol Slc9b1
Ensembl Gene ENSMUSG00000050150
Gene Namesolute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms
MMRRC Submission 038451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0190 (G1)
Quality Score93
Status Not validated
Chromosome3
Chromosomal Location135348029-135397827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135357673 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 73 (E73K)
Ref Sequence ENSEMBL: ENSMUSP00000124452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078568] [ENSMUST00000159658]
Predicted Effect unknown
Transcript: ENSMUST00000078568
AA Change: E95K
SMART Domains Protein: ENSMUSP00000077644
Gene: ENSMUSG00000050150
AA Change: E95K

DomainStartEndE-ValueType
low complexity region 32 105 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:Na_H_Exchanger 148 542 4.7e-31 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159658
AA Change: E73K
SMART Domains Protein: ENSMUSP00000124452
Gene: ENSMUSG00000050150
AA Change: E73K

DomainStartEndE-ValueType
low complexity region 10 83 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160460
SMART Domains Protein: ENSMUSP00000124902
Gene: ENSMUSG00000050150

DomainStartEndE-ValueType
low complexity region 32 105 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:Na_H_Exchanger 149 363 1.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162767
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 91.6%
  • 20x: 72.5%
Validation Efficiency 75% (45/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium/hydrogen exchanger and transmembrane protein. Highly conserved orthologs of this gene have been found in other mammalian species. The expression of this gene may be limited to testis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,392 probably null Het
Aff2 CA CAAA X: 69,849,105 probably null Het
Ankrd34a A G 3: 96,597,789 D103G probably damaging Het
Atp1b2 T C 11: 69,601,562 D224G probably damaging Het
Atxn10 A G 15: 85,336,529 D22G possibly damaging Het
B230118H07Rik G A 2: 101,586,430 S58L probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Caskin1 C T 17: 24,504,622 L795F possibly damaging Het
Cdk12 T C 11: 98,241,831 probably null Het
Crtc2 A G 3: 90,259,409 H91R probably damaging Het
Dbt A G 3: 116,539,087 probably null Het
Dda1 C A 8: 71,472,233 Y41* probably null Het
Dnah2 T A 11: 69,435,249 D3692V probably damaging Het
Dpep1 A G 8: 123,200,708 T334A probably benign Het
Enthd1 C T 15: 80,534,494 probably null Het
Fpr-rs6 T A 17: 20,182,479 I207F probably benign Het
Fsip2 T A 2: 82,985,177 S3751R possibly damaging Het
Gigyf2 A T 1: 87,428,688 probably benign Het
Gtf3c4 C A 2: 28,840,128 D34Y probably benign Het
Igfn1 A T 1: 135,962,052 V2419E probably damaging Het
Kank1 A T 19: 25,409,283 I79L probably benign Het
Kif21b A G 1: 136,171,219 H1415R probably benign Het
Mad2l1 T C 6: 66,539,878 S185P possibly damaging Het
Mettl18 A G 1: 163,996,422 E104G probably damaging Het
Mrgprb2 G A 7: 48,552,777 H67Y possibly damaging Het
Mrgprd G A 7: 145,321,702 M103I probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Nucks1 A G 1: 131,924,591 D60G probably damaging Het
Olfr1245 T A 2: 89,574,958 Y256F probably damaging Het
Olfr275 G C 4: 52,825,613 W72S probably damaging Het
Olfr978 A G 9: 39,994,544 I245V probably benign Het
Paqr8 A G 1: 20,935,047 T142A probably benign Het
Pdss1 T C 2: 22,906,831 S119P probably damaging Het
Plcl2 A G 17: 50,607,643 D560G probably benign Het
Ppm1b T A 17: 84,994,103 V137E probably damaging Het
Ppp1r16b A C 2: 158,696,063 K35Q probably damaging Het
Prkd2 A T 7: 16,869,890 E832V probably damaging Het
Rab34 G T 11: 78,191,406 K191N possibly damaging Het
Rad51ap2 A C 12: 11,458,539 T821P probably benign Het
Rbm19 A G 5: 120,144,046 T823A probably benign Het
Rpf2 T G 10: 40,227,601 H106P probably damaging Het
Schip1 A G 3: 68,625,844 M453V probably benign Het
Sema5a T A 15: 32,562,774 N310K possibly damaging Het
Sf3b1 T C 1: 54,990,306 D1179G probably damaging Het
Skint2 A T 4: 112,616,532 T4S possibly damaging Het
Slc22a5 A T 11: 53,869,415 Y358* probably null Het
Slc34a1 T C 13: 55,409,101 M251T probably benign Het
Slc44a5 A G 3: 154,239,118 D124G probably null Het
Ssbp2 T C 13: 91,669,710 L156P probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Trim47 A G 11: 116,106,227 V568A probably damaging Het
Ttn A T 2: 76,887,980 probably benign Het
Ttpa A T 4: 20,021,260 I74F probably damaging Het
Vmn2r52 T C 7: 10,171,388 I175V probably benign Het
Wrn C T 8: 33,240,983 C1350Y probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp422 A T 6: 116,626,611 D142E probably damaging Het
Zfp473 A T 7: 44,733,188 C574S probably damaging Het
Zfp638 T A 6: 83,928,964 M37K probably damaging Het
Zfp976 C A 7: 42,642,524 probably benign Het
Other mutations in Slc9b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Slc9b1 APN 3 135371982 unclassified probably null
IGL02793:Slc9b1 APN 3 135374406 unclassified probably benign
IGL02875:Slc9b1 APN 3 135374406 unclassified probably benign
IGL02977:Slc9b1 APN 3 135397723 missense probably damaging 1.00
IGL02990:Slc9b1 APN 3 135394983 splice site probably null
IGL03112:Slc9b1 APN 3 135397672 missense probably damaging 1.00
IGL03277:Slc9b1 APN 3 135390508 missense possibly damaging 0.46
IGL03409:Slc9b1 APN 3 135394909 missense probably damaging 0.99
R0329:Slc9b1 UTSW 3 135373235 nonsense probably null
R0591:Slc9b1 UTSW 3 135382832 missense possibly damaging 0.88
R0592:Slc9b1 UTSW 3 135394074 splice site probably benign
R0602:Slc9b1 UTSW 3 135397755 missense probably benign 0.00
R0893:Slc9b1 UTSW 3 135394890 missense probably benign 0.15
R1250:Slc9b1 UTSW 3 135348770 start codon destroyed probably null
R1619:Slc9b1 UTSW 3 135355004 splice site probably null
R1840:Slc9b1 UTSW 3 135357468 missense unknown
R3157:Slc9b1 UTSW 3 135371845 missense probably damaging 1.00
R3159:Slc9b1 UTSW 3 135371845 missense probably damaging 1.00
R4565:Slc9b1 UTSW 3 135382717 missense probably damaging 1.00
R5138:Slc9b1 UTSW 3 135357773 intron probably benign
R5154:Slc9b1 UTSW 3 135373179 missense probably damaging 1.00
R5429:Slc9b1 UTSW 3 135373263 critical splice donor site probably null
R5677:Slc9b1 UTSW 3 135357559 missense unknown
R5903:Slc9b1 UTSW 3 135392894 intron probably benign
R5933:Slc9b1 UTSW 3 135393995 missense probably benign 0.30
R6593:Slc9b1 UTSW 3 135357458 start codon destroyed probably null
R6667:Slc9b1 UTSW 3 135371965 missense probably damaging 0.99
R6788:Slc9b1 UTSW 3 135357757 splice site probably null
RF006:Slc9b1 UTSW 3 135357542 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AACTGTGGAACCAAAACCAGAACTGA -3'
(R):5'- CCTTCAACTAACATGGCTTCTAATCCCC -3'

Sequencing Primer
(F):5'- ACCAGAACTGAAGGAACCG -3'
(R):5'- ATCAGAGCTTGCCATCTGAG -3'
Posted On2013-05-24