Incidental Mutation 'R5549:Ccr5'
ID435046
Institutional Source Beutler Lab
Gene Symbol Ccr5
Ensembl Gene ENSMUSG00000079227
Gene Namechemokine (C-C motif) receptor 5
SynonymsCmkbr5, CD195
MMRRC Submission 043106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5549 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location124121543-124147699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124125371 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 337 (A337E)
Ref Sequence ENSEMBL: ENSMUSP00000107069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111442] [ENSMUST00000168179] [ENSMUST00000171499]
Predicted Effect probably benign
Transcript: ENSMUST00000097855
Predicted Effect probably benign
Transcript: ENSMUST00000111442
AA Change: A337E

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107069
Gene: ENSMUSG00000079227
AA Change: A337E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 314 3.8e-6 PFAM
Pfam:7tm_1 49 299 3.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169553
Predicted Effect probably benign
Transcript: ENSMUST00000171499
SMART Domains Protein: ENSMUSP00000127328
Gene: ENSMUSG00000079227

DomainStartEndE-ValueType
Pfam:7tm_1 49 123 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171579
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice that are homozygous for null alleles have leukocytes with defective migration and adhesion, are more susceptibility to fungal & bacterial infections, have increased length of allograft survival, and have decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,036 E324G possibly damaging Het
Acad8 C T 9: 26,985,551 R204Q probably damaging Het
Adgrg7 T G 16: 56,750,427 T413P probably damaging Het
Ankrd11 A G 8: 122,890,378 I2224T probably benign Het
Arhgap23 A G 11: 97,466,568 D964G probably damaging Het
Atf6b A G 17: 34,651,683 D367G probably damaging Het
Axdnd1 A G 1: 156,398,534 L131P probably damaging Het
BC003331 A G 1: 150,372,158 S325P possibly damaging Het
Bmp8b T C 4: 123,124,485 V383A probably damaging Het
C5ar2 A G 7: 16,236,943 V353A probably damaging Het
Cftr G A 6: 18,227,954 V382I probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Cyp2d12 A G 15: 82,556,297 T96A probably benign Het
Diaph3 T G 14: 86,978,670 I465L probably benign Het
Fabp3 A G 4: 130,315,225 *134W probably null Het
Fam213a T C 14: 41,004,056 K44E possibly damaging Het
Fgf22 G T 10: 79,756,862 M130I probably damaging Het
Flnc G A 6: 29,453,691 V1792M probably damaging Het
Grik3 G A 4: 125,686,045 A528T possibly damaging Het
Hecw2 G A 1: 53,925,691 R659W possibly damaging Het
Hmbs C T 9: 44,339,477 probably null Het
Ift122 T G 6: 115,892,022 L490R probably damaging Het
Igkv4-63 T C 6: 69,378,132 H55R probably damaging Het
Itga4 A T 2: 79,256,267 N96I probably damaging Het
Kcna7 A T 7: 45,406,639 H93L probably damaging Het
Klhdc7b A G 15: 89,387,359 I815V probably benign Het
Lcmt1 G A 7: 123,428,107 E298K probably damaging Het
Ly6g6f A G 17: 35,083,357 V68A possibly damaging Het
Map3k8 C T 18: 4,340,762 C184Y probably damaging Het
Mcemp1 A G 8: 3,668,340 T183A possibly damaging Het
Mobp T G 9: 120,167,810 S2R probably damaging Het
Mprip A G 11: 59,760,818 S1783G probably benign Het
Mterf3 C A 13: 66,928,257 A129S probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nr2c1 A G 10: 94,167,696 T239A probably benign Het
Olfr541 A G 7: 140,704,799 probably null Het
Oplah G A 15: 76,298,266 A963V probably damaging Het
Parp14 C T 16: 35,841,135 S1481N probably benign Het
Rictor C T 15: 6,786,910 T1221M probably damaging Het
Rpe G A 1: 66,716,004 D182N probably damaging Het
Slc24a3 C A 2: 145,606,864 P443T probably damaging Het
Slc25a47 T C 12: 108,856,217 *311Q probably null Het
Sox2 C G 3: 34,650,993 A193G probably benign Het
Svep1 T C 4: 58,057,954 S3284G probably benign Het
Zfp369 A T 13: 65,297,380 H779L probably damaging Het
Zfp513 A T 5: 31,200,603 L144Q possibly damaging Het
Zfp526 T C 7: 25,225,684 F456S possibly damaging Het
Zfp791 C T 8: 85,110,206 G343D probably damaging Het
Zfp941 A C 7: 140,808,108 I664S possibly damaging Het
Zkscan3 A G 13: 21,394,063 V189A probably damaging Het
Other mutations in Ccr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ccr5 APN 9 124124406 missense possibly damaging 0.59
IGL00551:Ccr5 APN 9 124124588 missense probably damaging 1.00
IGL01153:Ccr5 APN 9 124124612 missense probably damaging 1.00
R0014:Ccr5 UTSW 9 124124621 missense probably damaging 1.00
R0014:Ccr5 UTSW 9 124124621 missense probably damaging 1.00
R0355:Ccr5 UTSW 9 124124914 missense possibly damaging 0.90
R1570:Ccr5 UTSW 9 124124963 missense probably benign 0.29
R4305:Ccr5 UTSW 9 124125074 missense possibly damaging 0.78
R4307:Ccr5 UTSW 9 124125074 missense possibly damaging 0.78
R4570:Ccr5 UTSW 9 124124875 nonsense probably null
R4589:Ccr5 UTSW 9 124124502 missense probably benign 0.00
R5566:Ccr5 UTSW 9 124124660 missense probably benign 0.07
R5871:Ccr5 UTSW 9 124124521 missense probably benign 0.02
R6568:Ccr5 UTSW 9 124125199 missense probably damaging 0.99
R7258:Ccr5 UTSW 9 124125274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGCAACAGAGACTCTTGG -3'
(R):5'- ATAAAAGACTCGTTCTCCCTGC -3'

Sequencing Primer
(F):5'- TTGGAATGACACACTGCTGC -3'
(R):5'- TCCCCATTCAGTTTTAAAAGACCC -3'
Posted On2016-10-24