Incidental Mutation 'R5549:Slc25a47'
ID435053
Institutional Source Beutler Lab
Gene Symbol Slc25a47
Ensembl Gene ENSMUSG00000048856
Gene Namesolute carrier family 25, member 47
Synonyms
MMRRC Submission 043106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5549 (G1)
Quality Score207
Status Not validated
Chromosome12
Chromosomal Location108836046-108856815 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 108856217 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 311 (*311Q)
Ref Sequence ENSEMBL: ENSMUSP00000050329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057026] [ENSMUST00000109848] [ENSMUST00000160477] [ENSMUST00000161154] [ENSMUST00000161410] [ENSMUST00000221080]
Predicted Effect probably null
Transcript: ENSMUST00000057026
AA Change: *311Q
SMART Domains Protein: ENSMUSP00000050329
Gene: ENSMUSG00000048856
AA Change: *311Q

DomainStartEndE-ValueType
Pfam:Mito_carr 1 84 1.2e-19 PFAM
Pfam:Mito_carr 94 212 1.5e-19 PFAM
Pfam:Mito_carr 215 308 6.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109848
SMART Domains Protein: ENSMUSP00000105474
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 447 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160477
Predicted Effect probably benign
Transcript: ENSMUST00000161154
SMART Domains Protein: ENSMUSP00000124625
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 446 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161410
SMART Domains Protein: ENSMUSP00000125320
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 447 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223296
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,036 E324G possibly damaging Het
Acad8 C T 9: 26,985,551 R204Q probably damaging Het
Adgrg7 T G 16: 56,750,427 T413P probably damaging Het
Ankrd11 A G 8: 122,890,378 I2224T probably benign Het
Arhgap23 A G 11: 97,466,568 D964G probably damaging Het
Atf6b A G 17: 34,651,683 D367G probably damaging Het
Axdnd1 A G 1: 156,398,534 L131P probably damaging Het
BC003331 A G 1: 150,372,158 S325P possibly damaging Het
Bmp8b T C 4: 123,124,485 V383A probably damaging Het
C5ar2 A G 7: 16,236,943 V353A probably damaging Het
Ccr5 C A 9: 124,125,371 A337E probably benign Het
Cftr G A 6: 18,227,954 V382I probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Cyp2d12 A G 15: 82,556,297 T96A probably benign Het
Diaph3 T G 14: 86,978,670 I465L probably benign Het
Fabp3 A G 4: 130,315,225 *134W probably null Het
Fam213a T C 14: 41,004,056 K44E possibly damaging Het
Fgf22 G T 10: 79,756,862 M130I probably damaging Het
Flnc G A 6: 29,453,691 V1792M probably damaging Het
Grik3 G A 4: 125,686,045 A528T possibly damaging Het
Hecw2 G A 1: 53,925,691 R659W possibly damaging Het
Hmbs C T 9: 44,339,477 probably null Het
Ift122 T G 6: 115,892,022 L490R probably damaging Het
Igkv4-63 T C 6: 69,378,132 H55R probably damaging Het
Itga4 A T 2: 79,256,267 N96I probably damaging Het
Kcna7 A T 7: 45,406,639 H93L probably damaging Het
Klhdc7b A G 15: 89,387,359 I815V probably benign Het
Lcmt1 G A 7: 123,428,107 E298K probably damaging Het
Ly6g6f A G 17: 35,083,357 V68A possibly damaging Het
Map3k8 C T 18: 4,340,762 C184Y probably damaging Het
Mcemp1 A G 8: 3,668,340 T183A possibly damaging Het
Mobp T G 9: 120,167,810 S2R probably damaging Het
Mprip A G 11: 59,760,818 S1783G probably benign Het
Mterf3 C A 13: 66,928,257 A129S probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nr2c1 A G 10: 94,167,696 T239A probably benign Het
Olfr541 A G 7: 140,704,799 probably null Het
Oplah G A 15: 76,298,266 A963V probably damaging Het
Parp14 C T 16: 35,841,135 S1481N probably benign Het
Rictor C T 15: 6,786,910 T1221M probably damaging Het
Rpe G A 1: 66,716,004 D182N probably damaging Het
Slc24a3 C A 2: 145,606,864 P443T probably damaging Het
Sox2 C G 3: 34,650,993 A193G probably benign Het
Svep1 T C 4: 58,057,954 S3284G probably benign Het
Zfp369 A T 13: 65,297,380 H779L probably damaging Het
Zfp513 A T 5: 31,200,603 L144Q possibly damaging Het
Zfp526 T C 7: 25,225,684 F456S possibly damaging Het
Zfp791 C T 8: 85,110,206 G343D probably damaging Het
Zfp941 A C 7: 140,808,108 I664S possibly damaging Het
Zkscan3 A G 13: 21,394,063 V189A probably damaging Het
Other mutations in Slc25a47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Slc25a47 APN 12 108855388 missense probably benign 0.00
IGL01138:Slc25a47 APN 12 108856022 missense probably damaging 1.00
IGL01545:Slc25a47 APN 12 108854216 missense probably benign 0.06
IGL01978:Slc25a47 APN 12 108851190 missense probably damaging 0.96
R0592:Slc25a47 UTSW 12 108854258 missense probably damaging 0.98
R4783:Slc25a47 UTSW 12 108855334 missense probably damaging 1.00
R6085:Slc25a47 UTSW 12 108854328 missense probably benign 0.19
R6378:Slc25a47 UTSW 12 108856143 missense probably damaging 1.00
R6612:Slc25a47 UTSW 12 108855978 missense probably benign 0.02
R7237:Slc25a47 UTSW 12 108855460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCATGGATGTGATCAAGTC -3'
(R):5'- GCAGATGGCAGATCAACTCC -3'

Sequencing Primer
(F):5'- TGATCAAGTCACGCCTGCAG -3'
(R):5'- ATGGCAGATCAACTCCCTGATTTTG -3'
Posted On2016-10-24