Incidental Mutation 'R5549:Mterf3'
ID435056
Institutional Source Beutler Lab
Gene Symbol Mterf3
Ensembl Gene ENSMUSG00000021519
Gene Namemitochondrial transcription termination factor 3
Synonyms2410017I18Rik, Mterfd1
MMRRC Submission 043106-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5549 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location66906968-66933088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66928257 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 129 (A129S)
Ref Sequence ENSEMBL: ENSMUSP00000152951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021990] [ENSMUST00000021991] [ENSMUST00000172597] [ENSMUST00000173158] [ENSMUST00000173407] [ENSMUST00000173773] [ENSMUST00000173910] [ENSMUST00000174339] [ENSMUST00000224085] [ENSMUST00000224244]
Predicted Effect probably benign
Transcript: ENSMUST00000021990
SMART Domains Protein: ENSMUSP00000021990
Gene: ENSMUSG00000021518

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 72 89 N/A INTRINSIC
Pfam:PSS 96 372 1.3e-108 PFAM
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 442 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021991
AA Change: A129S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000021991
Gene: ENSMUSG00000021519
AA Change: A129S

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Mterf 161 196 1.63e3 SMART
Mterf 201 231 7.37e-1 SMART
Mterf 236 267 4.68e-3 SMART
Mterf 272 303 2.12e-1 SMART
Mterf 308 339 4.11e1 SMART
Mterf 340 370 9.22e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172597
AA Change: A129S

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133433
Gene: ENSMUSG00000021519
AA Change: A129S

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
PDB:3OPG|A 121 204 2e-40 PDB
Blast:Mterf 161 196 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173062
Predicted Effect unknown
Transcript: ENSMUST00000173158
AA Change: C117F
SMART Domains Protein: ENSMUSP00000134032
Gene: ENSMUSG00000021519
AA Change: C117F

DomainStartEndE-ValueType
low complexity region 97 108 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173407
AA Change: C117F
SMART Domains Protein: ENSMUSP00000133594
Gene: ENSMUSG00000021519
AA Change: C117F

DomainStartEndE-ValueType
low complexity region 97 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173773
Predicted Effect unknown
Transcript: ENSMUST00000173910
AA Change: L36F
SMART Domains Protein: ENSMUSP00000133456
Gene: ENSMUSG00000021519
AA Change: L36F

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174011
Predicted Effect probably benign
Transcript: ENSMUST00000174339
SMART Domains Protein: ENSMUSP00000134286
Gene: ENSMUSG00000021519

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224085
AA Change: A129S

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000224244
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit embryonic growth retardation and die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,036 E324G possibly damaging Het
Acad8 C T 9: 26,985,551 R204Q probably damaging Het
Adgrg7 T G 16: 56,750,427 T413P probably damaging Het
Ankrd11 A G 8: 122,890,378 I2224T probably benign Het
Arhgap23 A G 11: 97,466,568 D964G probably damaging Het
Atf6b A G 17: 34,651,683 D367G probably damaging Het
Axdnd1 A G 1: 156,398,534 L131P probably damaging Het
BC003331 A G 1: 150,372,158 S325P possibly damaging Het
Bmp8b T C 4: 123,124,485 V383A probably damaging Het
C5ar2 A G 7: 16,236,943 V353A probably damaging Het
Ccr5 C A 9: 124,125,371 A337E probably benign Het
Cftr G A 6: 18,227,954 V382I probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Cyp2d12 A G 15: 82,556,297 T96A probably benign Het
Diaph3 T G 14: 86,978,670 I465L probably benign Het
Fabp3 A G 4: 130,315,225 *134W probably null Het
Fam213a T C 14: 41,004,056 K44E possibly damaging Het
Fgf22 G T 10: 79,756,862 M130I probably damaging Het
Flnc G A 6: 29,453,691 V1792M probably damaging Het
Grik3 G A 4: 125,686,045 A528T possibly damaging Het
Hecw2 G A 1: 53,925,691 R659W possibly damaging Het
Hmbs C T 9: 44,339,477 probably null Het
Ift122 T G 6: 115,892,022 L490R probably damaging Het
Igkv4-63 T C 6: 69,378,132 H55R probably damaging Het
Itga4 A T 2: 79,256,267 N96I probably damaging Het
Kcna7 A T 7: 45,406,639 H93L probably damaging Het
Klhdc7b A G 15: 89,387,359 I815V probably benign Het
Lcmt1 G A 7: 123,428,107 E298K probably damaging Het
Ly6g6f A G 17: 35,083,357 V68A possibly damaging Het
Map3k8 C T 18: 4,340,762 C184Y probably damaging Het
Mcemp1 A G 8: 3,668,340 T183A possibly damaging Het
Mobp T G 9: 120,167,810 S2R probably damaging Het
Mprip A G 11: 59,760,818 S1783G probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nr2c1 A G 10: 94,167,696 T239A probably benign Het
Olfr541 A G 7: 140,704,799 probably null Het
Oplah G A 15: 76,298,266 A963V probably damaging Het
Parp14 C T 16: 35,841,135 S1481N probably benign Het
Rictor C T 15: 6,786,910 T1221M probably damaging Het
Rpe G A 1: 66,716,004 D182N probably damaging Het
Slc24a3 C A 2: 145,606,864 P443T probably damaging Het
Slc25a47 T C 12: 108,856,217 *311Q probably null Het
Sox2 C G 3: 34,650,993 A193G probably benign Het
Svep1 T C 4: 58,057,954 S3284G probably benign Het
Zfp369 A T 13: 65,297,380 H779L probably damaging Het
Zfp513 A T 5: 31,200,603 L144Q possibly damaging Het
Zfp526 T C 7: 25,225,684 F456S possibly damaging Het
Zfp791 C T 8: 85,110,206 G343D probably damaging Het
Zfp941 A C 7: 140,808,108 I664S possibly damaging Het
Zkscan3 A G 13: 21,394,063 V189A probably damaging Het
Other mutations in Mterf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03106:Mterf3 APN 13 66930157 missense probably damaging 1.00
R0630:Mterf3 UTSW 13 66912308 missense probably damaging 1.00
R0636:Mterf3 UTSW 13 66922753 intron probably benign
R1403:Mterf3 UTSW 13 66929880 unclassified probably benign
R1447:Mterf3 UTSW 13 66917039 missense probably damaging 1.00
R1573:Mterf3 UTSW 13 66922903 missense possibly damaging 0.73
R1919:Mterf3 UTSW 13 66930062 missense probably damaging 0.97
R2327:Mterf3 UTSW 13 66928194 missense probably damaging 1.00
R6590:Mterf3 UTSW 13 66917046 missense probably damaging 1.00
R6690:Mterf3 UTSW 13 66917046 missense probably damaging 1.00
R7599:Mterf3 UTSW 13 66917148 missense probably damaging 1.00
R8297:Mterf3 UTSW 13 66907158 missense
Predicted Primers PCR Primer
(F):5'- TCAGGGGATATTACATGGCAAAC -3'
(R):5'- TGGAAATAGATCTTGCATTGTCCC -3'

Sequencing Primer
(F):5'- CGGAGAACAGTACACCATGGGTC -3'
(R):5'- AATGCAGGTGCCTTTGAAGCC -3'
Posted On2016-10-24