Incidental Mutation 'R5549:Cyp2d12'
ID435063
Institutional Source Beutler Lab
Gene Symbol Cyp2d12
Ensembl Gene ENSMUSG00000096852
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 12
Synonyms
MMRRC Submission 043106-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5549 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82555072-82560403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82556297 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 96 (T96A)
Ref Sequence ENSEMBL: ENSMUSP00000154856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068861] [ENSMUST00000228974] [ENSMUST00000229103] [ENSMUST00000229904]
Predicted Effect probably benign
Transcript: ENSMUST00000068861
AA Change: T96A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071064
Gene: ENSMUSG00000096852
AA Change: T96A

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:p450 37 497 3.6e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184191
Predicted Effect unknown
Transcript: ENSMUST00000228974
AA Change: D86G
Predicted Effect probably benign
Transcript: ENSMUST00000229103
AA Change: T21A

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229792
Predicted Effect probably benign
Transcript: ENSMUST00000229904
AA Change: T96A

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230859
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,036 E324G possibly damaging Het
Acad8 C T 9: 26,985,551 R204Q probably damaging Het
Adgrg7 T G 16: 56,750,427 T413P probably damaging Het
Ankrd11 A G 8: 122,890,378 I2224T probably benign Het
Arhgap23 A G 11: 97,466,568 D964G probably damaging Het
Atf6b A G 17: 34,651,683 D367G probably damaging Het
Axdnd1 A G 1: 156,398,534 L131P probably damaging Het
BC003331 A G 1: 150,372,158 S325P possibly damaging Het
Bmp8b T C 4: 123,124,485 V383A probably damaging Het
C5ar2 A G 7: 16,236,943 V353A probably damaging Het
Ccr5 C A 9: 124,125,371 A337E probably benign Het
Cftr G A 6: 18,227,954 V382I probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Diaph3 T G 14: 86,978,670 I465L probably benign Het
Fabp3 A G 4: 130,315,225 *134W probably null Het
Fam213a T C 14: 41,004,056 K44E possibly damaging Het
Fgf22 G T 10: 79,756,862 M130I probably damaging Het
Flnc G A 6: 29,453,691 V1792M probably damaging Het
Grik3 G A 4: 125,686,045 A528T possibly damaging Het
Hecw2 G A 1: 53,925,691 R659W possibly damaging Het
Hmbs C T 9: 44,339,477 probably null Het
Ift122 T G 6: 115,892,022 L490R probably damaging Het
Igkv4-63 T C 6: 69,378,132 H55R probably damaging Het
Itga4 A T 2: 79,256,267 N96I probably damaging Het
Kcna7 A T 7: 45,406,639 H93L probably damaging Het
Klhdc7b A G 15: 89,387,359 I815V probably benign Het
Lcmt1 G A 7: 123,428,107 E298K probably damaging Het
Ly6g6f A G 17: 35,083,357 V68A possibly damaging Het
Map3k8 C T 18: 4,340,762 C184Y probably damaging Het
Mcemp1 A G 8: 3,668,340 T183A possibly damaging Het
Mobp T G 9: 120,167,810 S2R probably damaging Het
Mprip A G 11: 59,760,818 S1783G probably benign Het
Mterf3 C A 13: 66,928,257 A129S probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nr2c1 A G 10: 94,167,696 T239A probably benign Het
Olfr541 A G 7: 140,704,799 probably null Het
Oplah G A 15: 76,298,266 A963V probably damaging Het
Parp14 C T 16: 35,841,135 S1481N probably benign Het
Rictor C T 15: 6,786,910 T1221M probably damaging Het
Rpe G A 1: 66,716,004 D182N probably damaging Het
Slc24a3 C A 2: 145,606,864 P443T probably damaging Het
Slc25a47 T C 12: 108,856,217 *311Q probably null Het
Sox2 C G 3: 34,650,993 A193G probably benign Het
Svep1 T C 4: 58,057,954 S3284G probably benign Het
Zfp369 A T 13: 65,297,380 H779L probably damaging Het
Zfp513 A T 5: 31,200,603 L144Q possibly damaging Het
Zfp526 T C 7: 25,225,684 F456S possibly damaging Het
Zfp791 C T 8: 85,110,206 G343D probably damaging Het
Zfp941 A C 7: 140,808,108 I664S possibly damaging Het
Zkscan3 A G 13: 21,394,063 V189A probably damaging Het
Other mutations in Cyp2d12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Cyp2d12 APN 15 82555344 splice site probably benign
IGL02318:Cyp2d12 APN 15 82555243 missense probably benign 0.33
IGL02353:Cyp2d12 APN 15 82558970 missense probably benign 0.02
IGL02360:Cyp2d12 APN 15 82558970 missense probably benign 0.02
IGL02491:Cyp2d12 APN 15 82558481 missense possibly damaging 0.88
IGL02651:Cyp2d12 APN 15 82556740 missense probably damaging 0.99
IGL02664:Cyp2d12 APN 15 82559334 missense probably benign
IGL03169:Cyp2d12 APN 15 82559291 missense probably benign 0.00
IGL03354:Cyp2d12 APN 15 82558961 missense probably damaging 1.00
PIT4581001:Cyp2d12 UTSW 15 82558451 missense probably damaging 1.00
R0426:Cyp2d12 UTSW 15 82558963 missense probably benign 0.12
R0578:Cyp2d12 UTSW 15 82556383 splice site probably benign
R1297:Cyp2d12 UTSW 15 82557686 missense probably benign 0.31
R1517:Cyp2d12 UTSW 15 82558136 missense probably damaging 1.00
R1718:Cyp2d12 UTSW 15 82558050 missense probably benign 0.00
R1829:Cyp2d12 UTSW 15 82558056 missense possibly damaging 0.87
R2208:Cyp2d12 UTSW 15 82556936 missense probably damaging 1.00
R2366:Cyp2d12 UTSW 15 82555154 missense probably damaging 1.00
R2385:Cyp2d12 UTSW 15 82558495 missense probably benign 0.00
R2504:Cyp2d12 UTSW 15 82559036 missense probably benign 0.06
R4009:Cyp2d12 UTSW 15 82556292 missense probably damaging 1.00
R4940:Cyp2d12 UTSW 15 82558050 missense probably benign 0.00
R5237:Cyp2d12 UTSW 15 82558006 splice site probably null
R5327:Cyp2d12 UTSW 15 82555222 missense probably benign 0.00
R6128:Cyp2d12 UTSW 15 82558965 missense probably benign
R6275:Cyp2d12 UTSW 15 82556658 missense probably benign 0.00
R6723:Cyp2d12 UTSW 15 82556884 missense probably benign
R6808:Cyp2d12 UTSW 15 82556733 missense probably damaging 1.00
R6947:Cyp2d12 UTSW 15 82559047 missense probably benign
R7137:Cyp2d12 UTSW 15 82557821 missense probably benign 0.42
R7224:Cyp2d12 UTSW 15 82557648 splice site probably null
R7513:Cyp2d12 UTSW 15 82558420 missense probably benign
R7698:Cyp2d12 UTSW 15 82558970 missense probably benign 0.02
R7753:Cyp2d12 UTSW 15 82556963 missense possibly damaging 0.68
X0065:Cyp2d12 UTSW 15 82557828 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGACATTGTTATTCAGTGAGCC -3'
(R):5'- AGTGCATGCCTTCTGGGTAG -3'

Sequencing Primer
(F):5'- CAGTGAGCCTGGTTCTATGATC -3'
(R):5'- TGCTGTGAATTGCTTGACCAC -3'
Posted On2016-10-24