Incidental Mutation 'R5550:Bdh2'
ID435081
Institutional Source Beutler Lab
Gene Symbol Bdh2
Ensembl Gene ENSMUSG00000028167
Gene Name3-hydroxybutyrate dehydrogenase, type 2
SynonymsDhrs6, 1810026B04Rik
MMRRC Submission 043107-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5550 (G1)
Quality Score191
Status Not validated
Chromosome3
Chromosomal Location135281221-135304426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135288313 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 52 (K52R)
Ref Sequence ENSEMBL: ENSMUSP00000112683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029817] [ENSMUST00000120397]
Predicted Effect probably benign
Transcript: ENSMUST00000029817
AA Change: K42R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000029817
Gene: ENSMUSG00000028167
AA Change: K42R

DomainStartEndE-ValueType
Pfam:adh_short 7 166 2.2e-26 PFAM
Pfam:KR 7 169 5.1e-7 PFAM
Pfam:adh_short_C2 12 244 6.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120397
AA Change: K52R

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112683
Gene: ENSMUSG00000028167
AA Change: K52R

DomainStartEndE-ValueType
Pfam:adh_short 7 166 2.2e-26 PFAM
Pfam:KR 7 169 5.1e-7 PFAM
Pfam:adh_short_C2 12 244 6.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198491
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 120,009,303 I1295M probably benign Het
Adgrb2 G T 4: 130,014,934 probably null Het
Adig A T 2: 158,507,960 probably benign Het
Atp5o C A 16: 91,930,404 V15F probably damaging Het
Bud23 A G 5: 135,063,890 V27A probably benign Het
Ces2b A G 8: 104,838,437 D551G probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Dio3 A T 12: 110,280,126 T299S probably benign Het
Dnah1 T A 14: 31,316,708 I139F probably benign Het
Dpy30 A G 17: 74,315,925 Y21H probably benign Het
Gbp4 C T 5: 105,122,045 V306M probably damaging Het
Gcat G A 15: 79,042,211 V94M probably benign Het
Henmt1 A G 3: 108,953,868 Y69C probably damaging Het
Hist3h2ba A G 11: 58,949,320 *127W probably null Het
Kank4 A G 4: 98,771,441 F800S probably benign Het
Lrrc37a T A 11: 103,498,177 T2141S unknown Het
Map3k4 G A 17: 12,243,558 R1143* probably null Het
Mdc1 A G 17: 35,845,884 D61G possibly damaging Het
Nfkbid T A 7: 30,426,001 L303Q probably damaging Het
Olfr697 T C 7: 106,741,133 N267S probably benign Het
Olfr790 A G 10: 129,501,783 N300D probably damaging Het
P2ry1 T C 3: 61,003,811 C124R probably damaging Het
Sntg1 C T 1: 8,624,784 C153Y probably damaging Het
Speg A T 1: 75,429,100 T2983S probably damaging Het
Tbc1d2 G A 4: 46,646,138 P163S probably benign Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnks2 T A 19: 36,862,346 V78E probably damaging Het
Trip12 A G 1: 84,761,099 C709R probably damaging Het
Xpo5 T A 17: 46,234,492 V828D possibly damaging Het
Other mutations in Bdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Bdh2 APN 3 135288319 missense probably benign 0.13
R0684:Bdh2 UTSW 3 135291013 missense probably benign 0.01
R1398:Bdh2 UTSW 3 135295296 critical splice donor site probably benign
R1488:Bdh2 UTSW 3 135296841 missense probably damaging 1.00
R1688:Bdh2 UTSW 3 135301638 missense possibly damaging 0.77
R1968:Bdh2 UTSW 3 135285609 missense probably benign 0.12
R1969:Bdh2 UTSW 3 135288279 missense probably damaging 1.00
R2192:Bdh2 UTSW 3 135295264 missense probably damaging 1.00
R6749:Bdh2 UTSW 3 135300691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAATCCCTGTTCCTCCAATGACTG -3'
(R):5'- GACTGTACACACTGTTTCCCG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- CCGTAGGCCCTAGAATACAGATTTG -3'
Posted On2016-10-24