Incidental Mutation 'R5550:Kank4'
ID435083
Institutional Source Beutler Lab
Gene Symbol Kank4
Ensembl Gene ENSMUSG00000035407
Gene NameKN motif and ankyrin repeat domains 4
SynonymsAnkrd38
MMRRC Submission 043107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5550 (G1)
Quality Score207
Status Not validated
Chromosome4
Chromosomal Location98754898-98817537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98771441 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 800 (F800S)
Ref Sequence ENSEMBL: ENSMUSP00000099851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102790]
Predicted Effect probably benign
Transcript: ENSMUST00000102790
AA Change: F800S

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099851
Gene: ENSMUSG00000035407
AA Change: F800S

DomainStartEndE-ValueType
Pfam:KN_motif 24 62 5.6e-26 PFAM
low complexity region 280 295 N/A INTRINSIC
low complexity region 300 320 N/A INTRINSIC
coiled coil region 345 409 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 600 624 N/A INTRINSIC
low complexity region 625 655 N/A INTRINSIC
low complexity region 685 709 N/A INTRINSIC
ANK 838 868 7.42e-4 SMART
ANK 877 905 2.08e3 SMART
ANK 910 939 1.11e-2 SMART
ANK 943 973 8.99e-3 SMART
ANK 977 1006 2.43e3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137270
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 120,009,303 I1295M probably benign Het
Adgrb2 G T 4: 130,014,934 probably null Het
Adig A T 2: 158,507,960 probably benign Het
Atp5o C A 16: 91,930,404 V15F probably damaging Het
Bdh2 A G 3: 135,288,313 K52R probably benign Het
Bud23 A G 5: 135,063,890 V27A probably benign Het
Ces2b A G 8: 104,838,437 D551G probably benign Het
Csmd3 G C 15: 48,185,357 S446C probably damaging Het
Dio3 A T 12: 110,280,126 T299S probably benign Het
Dnah1 T A 14: 31,316,708 I139F probably benign Het
Dpy30 A G 17: 74,315,925 Y21H probably benign Het
Gbp4 C T 5: 105,122,045 V306M probably damaging Het
Gcat G A 15: 79,042,211 V94M probably benign Het
Henmt1 A G 3: 108,953,868 Y69C probably damaging Het
Hist3h2ba A G 11: 58,949,320 *127W probably null Het
Lrrc37a T A 11: 103,498,177 T2141S unknown Het
Map3k4 G A 17: 12,243,558 R1143* probably null Het
Mdc1 A G 17: 35,845,884 D61G possibly damaging Het
Nfkbid T A 7: 30,426,001 L303Q probably damaging Het
Olfr697 T C 7: 106,741,133 N267S probably benign Het
Olfr790 A G 10: 129,501,783 N300D probably damaging Het
P2ry1 T C 3: 61,003,811 C124R probably damaging Het
Sntg1 C T 1: 8,624,784 C153Y probably damaging Het
Speg A T 1: 75,429,100 T2983S probably damaging Het
Tbc1d2 G A 4: 46,646,138 P163S probably benign Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tnks2 T A 19: 36,862,346 V78E probably damaging Het
Trip12 A G 1: 84,761,099 C709R probably damaging Het
Xpo5 T A 17: 46,234,492 V828D possibly damaging Het
Other mutations in Kank4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Kank4 APN 4 98778395 missense probably damaging 0.99
IGL02634:Kank4 APN 4 98778827 missense probably benign 0.06
IGL02883:Kank4 APN 4 98773453 missense possibly damaging 0.87
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0040:Kank4 UTSW 4 98779220 missense probably benign 0.03
R0081:Kank4 UTSW 4 98778330 missense probably benign 0.02
R0219:Kank4 UTSW 4 98778465 missense probably benign 0.06
R0498:Kank4 UTSW 4 98779636 missense probably benign
R0609:Kank4 UTSW 4 98777105 missense probably damaging 0.99
R0855:Kank4 UTSW 4 98771444 missense probably damaging 1.00
R0865:Kank4 UTSW 4 98774663 splice site probably benign
R0961:Kank4 UTSW 4 98756519 missense probably benign 0.02
R1172:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1173:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1175:Kank4 UTSW 4 98765569 missense probably damaging 1.00
R1381:Kank4 UTSW 4 98779938 missense probably damaging 0.98
R1517:Kank4 UTSW 4 98779029 missense possibly damaging 0.83
R1573:Kank4 UTSW 4 98774836 nonsense probably null
R1668:Kank4 UTSW 4 98778896 missense probably damaging 0.98
R2051:Kank4 UTSW 4 98780102 missense probably damaging 0.99
R2253:Kank4 UTSW 4 98779226 missense probably damaging 0.99
R2656:Kank4 UTSW 4 98778957 missense probably damaging 0.99
R3801:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3802:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3804:Kank4 UTSW 4 98780133 missense probably damaging 0.97
R3945:Kank4 UTSW 4 98771280 missense probably damaging 1.00
R4172:Kank4 UTSW 4 98779121 missense probably damaging 1.00
R4502:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R4503:Kank4 UTSW 4 98777098 missense possibly damaging 0.89
R5024:Kank4 UTSW 4 98785661 missense probably damaging 0.99
R5105:Kank4 UTSW 4 98779159 missense probably benign 0.01
R5122:Kank4 UTSW 4 98756567 missense probably damaging 1.00
R5255:Kank4 UTSW 4 98778972 missense probably benign
R5484:Kank4 UTSW 4 98774785 missense probably benign
R5517:Kank4 UTSW 4 98774881 missense probably damaging 1.00
R5667:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5671:Kank4 UTSW 4 98765461 critical splice donor site probably null
R5865:Kank4 UTSW 4 98771393 missense possibly damaging 0.50
R6176:Kank4 UTSW 4 98765554 missense probably damaging 1.00
R6778:Kank4 UTSW 4 98761505 missense probably benign 0.01
R7084:Kank4 UTSW 4 98771345 missense probably damaging 1.00
R7085:Kank4 UTSW 4 98779946 missense probably benign
R7112:Kank4 UTSW 4 98761521 missense probably damaging 0.99
R8307:Kank4 UTSW 4 98778678 nonsense probably null
R8431:Kank4 UTSW 4 98779272 missense probably benign 0.33
R8447:Kank4 UTSW 4 98778492 missense probably damaging 0.99
R8483:Kank4 UTSW 4 98771378 missense probably damaging 1.00
R8505:Kank4 UTSW 4 98785676 start gained probably benign
X0027:Kank4 UTSW 4 98779923 missense probably benign 0.00
Z1176:Kank4 UTSW 4 98778294 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTAGCTTGACAATGGCGAAG -3'
(R):5'- TTGGGCATTGAATGTGCAGC -3'

Sequencing Primer
(F):5'- CTTGACAATGGCGAAGTTGGAGTG -3'
(R):5'- CATTGAATGTGCAGCAGGATTC -3'
Posted On2016-10-24