Incidental Mutation 'R5550:Map3k4'
ID 435098
Institutional Source Beutler Lab
Gene Symbol Map3k4
Ensembl Gene ENSMUSG00000014426
Gene Name mitogen-activated protein kinase kinase kinase 4
Synonyms T-associated sex reversal, D17Rp17, D17Rp17e, Mekk4, Tas, RP17, MAPKKK4, MTK1
MMRRC Submission 043107-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R5550 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 12446508-12537683 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 12462445 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1143 (R1143*)
Ref Sequence ENSEMBL: ENSMUSP00000086459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089058]
AlphaFold O08648
Predicted Effect probably null
Transcript: ENSMUST00000089058
AA Change: R1143*
SMART Domains Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426
AA Change: R1143*

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 215 235 N/A INTRINSIC
low complexity region 432 462 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
S_TKc 1332 1590 1.41e-91 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 119,900,129 (GRCm39) I1295M probably benign Het
Adgrb2 G T 4: 129,908,727 (GRCm39) probably null Het
Adig A T 2: 158,349,880 (GRCm39) probably benign Het
Atp5po C A 16: 91,727,292 (GRCm39) V15F probably damaging Het
Bdh2 A G 3: 134,994,074 (GRCm39) K52R probably benign Het
Bud23 A G 5: 135,092,744 (GRCm39) V27A probably benign Het
Ces2b A G 8: 105,565,069 (GRCm39) D551G probably benign Het
Csmd3 G C 15: 48,048,753 (GRCm39) S446C probably damaging Het
Dio3 A T 12: 110,246,560 (GRCm39) T299S probably benign Het
Dnah1 T A 14: 31,038,665 (GRCm39) I139F probably benign Het
Dpy30 A G 17: 74,622,920 (GRCm39) Y21H probably benign Het
Gbp4 C T 5: 105,269,911 (GRCm39) V306M probably damaging Het
Gcat G A 15: 78,926,411 (GRCm39) V94M probably benign Het
H2bc27 A G 11: 58,840,146 (GRCm39) *127W probably null Het
Henmt1 A G 3: 108,861,184 (GRCm39) Y69C probably damaging Het
Kank4 A G 4: 98,659,678 (GRCm39) F800S probably benign Het
Lrrc37a T A 11: 103,389,003 (GRCm39) T2141S unknown Het
Mdc1 A G 17: 36,156,776 (GRCm39) D61G possibly damaging Het
Nfkbid T A 7: 30,125,426 (GRCm39) L303Q probably damaging Het
Or2ag15 T C 7: 106,340,340 (GRCm39) N267S probably benign Het
Or6c75 A G 10: 129,337,652 (GRCm39) N300D probably damaging Het
P2ry1 T C 3: 60,911,232 (GRCm39) C124R probably damaging Het
Sntg1 C T 1: 8,695,008 (GRCm39) C153Y probably damaging Het
Speg A T 1: 75,405,744 (GRCm39) T2983S probably damaging Het
Tbc1d2 G A 4: 46,646,138 (GRCm39) P163S probably benign Het
Tdpoz4 A T 3: 93,704,806 (GRCm39) T368S probably benign Het
Tnks2 T A 19: 36,839,746 (GRCm39) V78E probably damaging Het
Trip12 A G 1: 84,738,820 (GRCm39) C709R probably damaging Het
Xpo5 T A 17: 46,545,418 (GRCm39) V828D possibly damaging Het
Other mutations in Map3k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Map3k4 APN 17 12,451,877 (GRCm39) missense probably damaging 1.00
IGL01124:Map3k4 APN 17 12,474,087 (GRCm39) missense probably benign 0.01
IGL01125:Map3k4 APN 17 12,490,849 (GRCm39) missense probably damaging 0.96
IGL01585:Map3k4 APN 17 12,467,846 (GRCm39) missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12,482,815 (GRCm39) missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12,467,882 (GRCm39) missense probably benign 0.30
IGL02292:Map3k4 APN 17 12,454,045 (GRCm39) missense possibly damaging 0.77
IGL02326:Map3k4 APN 17 12,467,897 (GRCm39) missense probably damaging 1.00
IGL02388:Map3k4 APN 17 12,490,497 (GRCm39) missense probably damaging 0.99
IGL02621:Map3k4 APN 17 12,482,900 (GRCm39) missense probably damaging 1.00
IGL02668:Map3k4 APN 17 12,454,840 (GRCm39) missense possibly damaging 0.85
IGL02850:Map3k4 APN 17 12,490,801 (GRCm39) missense probably damaging 1.00
IGL02939:Map3k4 APN 17 12,491,036 (GRCm39) missense probably damaging 1.00
IGL03148:Map3k4 APN 17 12,457,045 (GRCm39) missense probably benign 0.01
IGL03238:Map3k4 APN 17 12,490,045 (GRCm39) missense probably benign 0.10
ANU74:Map3k4 UTSW 17 12,451,863 (GRCm39) missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12,457,076 (GRCm39) missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12,457,076 (GRCm39) missense probably damaging 1.00
R0128:Map3k4 UTSW 17 12,466,950 (GRCm39) missense probably damaging 0.99
R0183:Map3k4 UTSW 17 12,454,015 (GRCm39) missense probably damaging 1.00
R0309:Map3k4 UTSW 17 12,489,902 (GRCm39) frame shift probably null
R0355:Map3k4 UTSW 17 12,473,058 (GRCm39) missense probably damaging 1.00
R0367:Map3k4 UTSW 17 12,476,928 (GRCm39) splice site probably benign
R1103:Map3k4 UTSW 17 12,455,950 (GRCm39) splice site probably null
R1446:Map3k4 UTSW 17 12,475,681 (GRCm39) nonsense probably null
R1542:Map3k4 UTSW 17 12,454,793 (GRCm39) missense probably damaging 0.97
R1713:Map3k4 UTSW 17 12,468,458 (GRCm39) missense probably benign 0.39
R1777:Map3k4 UTSW 17 12,490,617 (GRCm39) missense possibly damaging 0.82
R1797:Map3k4 UTSW 17 12,482,906 (GRCm39) missense probably benign 0.30
R1997:Map3k4 UTSW 17 12,473,882 (GRCm39) critical splice donor site probably null
R2042:Map3k4 UTSW 17 12,496,870 (GRCm39) missense probably damaging 0.99
R2878:Map3k4 UTSW 17 12,482,954 (GRCm39) missense probably benign 0.00
R2939:Map3k4 UTSW 17 12,480,157 (GRCm39) missense probably damaging 0.98
R2940:Map3k4 UTSW 17 12,480,157 (GRCm39) missense probably damaging 0.98
R3405:Map3k4 UTSW 17 12,475,668 (GRCm39) missense probably damaging 1.00
R3930:Map3k4 UTSW 17 12,454,880 (GRCm39) missense possibly damaging 0.83
R4291:Map3k4 UTSW 17 12,474,147 (GRCm39) missense probably benign 0.08
R4410:Map3k4 UTSW 17 12,467,885 (GRCm39) missense probably damaging 1.00
R4632:Map3k4 UTSW 17 12,451,391 (GRCm39) missense probably damaging 1.00
R4641:Map3k4 UTSW 17 12,482,932 (GRCm39) missense probably damaging 1.00
R4726:Map3k4 UTSW 17 12,451,851 (GRCm39) missense possibly damaging 0.89
R4730:Map3k4 UTSW 17 12,467,861 (GRCm39) missense probably damaging 0.99
R4832:Map3k4 UTSW 17 12,490,667 (GRCm39) missense probably damaging 1.00
R4896:Map3k4 UTSW 17 12,490,906 (GRCm39) missense possibly damaging 0.65
R4934:Map3k4 UTSW 17 12,490,787 (GRCm39) missense probably damaging 1.00
R4971:Map3k4 UTSW 17 12,468,382 (GRCm39) critical splice donor site probably null
R4980:Map3k4 UTSW 17 12,490,958 (GRCm39) missense probably damaging 1.00
R5211:Map3k4 UTSW 17 12,451,321 (GRCm39) missense possibly damaging 0.88
R5337:Map3k4 UTSW 17 12,490,497 (GRCm39) missense probably damaging 0.99
R5356:Map3k4 UTSW 17 12,466,195 (GRCm39) missense possibly damaging 0.87
R5824:Map3k4 UTSW 17 12,448,526 (GRCm39) missense probably damaging 1.00
R5890:Map3k4 UTSW 17 12,490,303 (GRCm39) missense probably damaging 1.00
R6285:Map3k4 UTSW 17 12,482,945 (GRCm39) missense probably damaging 1.00
R6380:Map3k4 UTSW 17 12,490,954 (GRCm39) missense possibly damaging 0.56
R6383:Map3k4 UTSW 17 12,468,470 (GRCm39) missense possibly damaging 0.82
R6571:Map3k4 UTSW 17 12,461,579 (GRCm39) missense possibly damaging 0.80
R6584:Map3k4 UTSW 17 12,479,378 (GRCm39) missense probably damaging 1.00
R6616:Map3k4 UTSW 17 12,490,231 (GRCm39) missense probably damaging 1.00
R6644:Map3k4 UTSW 17 12,451,297 (GRCm39) critical splice donor site probably null
R6909:Map3k4 UTSW 17 12,489,872 (GRCm39) missense probably damaging 1.00
R6947:Map3k4 UTSW 17 12,479,456 (GRCm39) nonsense probably null
R6970:Map3k4 UTSW 17 12,467,803 (GRCm39) missense probably damaging 1.00
R7120:Map3k4 UTSW 17 12,490,354 (GRCm39) missense probably damaging 1.00
R7253:Map3k4 UTSW 17 12,490,955 (GRCm39) missense probably benign 0.00
R7267:Map3k4 UTSW 17 12,490,536 (GRCm39) nonsense probably null
R7322:Map3k4 UTSW 17 12,489,833 (GRCm39) missense probably damaging 1.00
R7522:Map3k4 UTSW 17 12,480,219 (GRCm39) missense probably benign 0.39
R7554:Map3k4 UTSW 17 12,451,301 (GRCm39) nonsense probably null
R7554:Map3k4 UTSW 17 12,451,300 (GRCm39) missense probably damaging 1.00
R7681:Map3k4 UTSW 17 12,537,430 (GRCm39) missense unknown
R7734:Map3k4 UTSW 17 12,482,998 (GRCm39) missense probably damaging 1.00
R7842:Map3k4 UTSW 17 12,490,030 (GRCm39) missense possibly damaging 0.54
R8013:Map3k4 UTSW 17 12,489,918 (GRCm39) nonsense probably null
R8014:Map3k4 UTSW 17 12,489,918 (GRCm39) nonsense probably null
R8235:Map3k4 UTSW 17 12,458,968 (GRCm39) splice site probably null
R8294:Map3k4 UTSW 17 12,537,500 (GRCm39) missense unknown
R8528:Map3k4 UTSW 17 12,451,821 (GRCm39) missense probably damaging 1.00
R8858:Map3k4 UTSW 17 12,490,759 (GRCm39) missense probably damaging 1.00
R8924:Map3k4 UTSW 17 12,490,433 (GRCm39) missense probably benign 0.00
R9063:Map3k4 UTSW 17 12,482,878 (GRCm39) missense probably damaging 1.00
R9224:Map3k4 UTSW 17 12,456,973 (GRCm39) missense probably damaging 0.99
R9446:Map3k4 UTSW 17 12,451,375 (GRCm39) missense probably damaging 1.00
R9486:Map3k4 UTSW 17 12,489,860 (GRCm39) missense probably damaging 1.00
R9488:Map3k4 UTSW 17 12,489,860 (GRCm39) missense probably damaging 1.00
R9591:Map3k4 UTSW 17 12,454,795 (GRCm39) missense possibly damaging 0.91
R9617:Map3k4 UTSW 17 12,476,871 (GRCm39) missense possibly damaging 0.67
R9722:Map3k4 UTSW 17 12,490,523 (GRCm39) missense probably benign 0.01
X0067:Map3k4 UTSW 17 12,482,981 (GRCm39) missense probably benign 0.03
Z1177:Map3k4 UTSW 17 12,490,584 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTTAGGCAGTACGTGG -3'
(R):5'- GTGTAACATCACTTCTCCGAAGG -3'

Sequencing Primer
(F):5'- CAGTACGTGGCATCAGAAGAC -3'
(R):5'- GACGCTGTTGAAGTCCAT -3'
Posted On 2016-10-24