Incidental Mutation 'R5551:Sema4c'
ID 435105
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Name sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
Synonyms M-Sema F, Semacl1, Semaf, Semai, Semacl1
MMRRC Submission 043108-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5551 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 36587720-36597430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36591398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 348 (Y348H)
Ref Sequence ENSEMBL: ENSMUSP00000141527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001172] [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000195620] [ENSMUST00000195339]
AlphaFold Q64151
Predicted Effect probably benign
Transcript: ENSMUST00000001172
SMART Domains Protein: ENSMUSP00000001172
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 8.77e2 SMART
ANK 63 92 1.08e-5 SMART
ANK 96 127 1.27e-2 SMART
ANK 129 158 5.62e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114991
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: Y348H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191642
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: Y348H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191677
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: Y348H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191785
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Predicted Effect probably damaging
Transcript: ENSMUST00000195620
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: Y348H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195160
Predicted Effect probably benign
Transcript: ENSMUST00000195339
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB041806 G T 4: 138,123,312 (GRCm39) P3T probably damaging Het
Abl1 C T 2: 31,691,682 (GRCm39) A1048V probably benign Het
Acap2 A G 16: 30,923,726 (GRCm39) V659A probably damaging Het
Acox1 A G 11: 116,080,317 (GRCm39) S29P possibly damaging Het
Adamts1 A G 16: 85,594,634 (GRCm39) I405T probably benign Het
Afm A T 5: 90,679,511 (GRCm39) E335V probably null Het
Akap6 C T 12: 52,842,747 (GRCm39) P32S probably damaging Het
Alk T C 17: 72,182,028 (GRCm39) M1332V possibly damaging Het
Ankrd39 C T 1: 36,581,062 (GRCm39) G96R probably damaging Het
Atp2c1 C A 9: 105,336,936 (GRCm39) A16S probably damaging Het
Ccdc141 T C 2: 76,844,753 (GRCm39) E1438G probably damaging Het
Csmd2 T C 4: 128,404,741 (GRCm39) Y2376H possibly damaging Het
Csmd3 T C 15: 48,177,492 (GRCm39) T349A probably benign Het
Ctsr A T 13: 61,307,357 (GRCm39) M313K probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,619,462 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,031,718 (GRCm39) S3516P possibly damaging Het
Ehd4 A G 2: 119,958,100 (GRCm39) S162P possibly damaging Het
Ets2 T C 16: 95,513,165 (GRCm39) W114R probably damaging Het
Fignl1 A T 11: 11,751,603 (GRCm39) V484E probably damaging Het
Golph3 C A 15: 12,321,922 (GRCm39) S35R probably benign Het
Gzf1 T C 2: 148,526,248 (GRCm39) Y240H probably damaging Het
Hook3 A G 8: 26,558,639 (GRCm39) F75S possibly damaging Het
Ifi209 T A 1: 173,468,763 (GRCm39) S198T probably benign Het
Iqch A T 9: 63,403,535 (GRCm39) probably null Het
Katnip T C 7: 125,419,249 (GRCm39) F472S probably damaging Het
Lrrk2 C T 15: 91,696,553 (GRCm39) T2447I probably benign Het
Mesp2 T C 7: 79,461,367 (GRCm39) S231P probably benign Het
Muc5b T C 7: 141,422,240 (GRCm39) C4459R possibly damaging Het
Myh10 A G 11: 68,659,113 (GRCm39) E497G possibly damaging Het
Nalcn A T 14: 123,515,698 (GRCm39) V1701E possibly damaging Het
Nat8f1 T C 6: 85,887,891 (GRCm39) D23G probably damaging Het
Nfia G A 4: 97,902,497 (GRCm39) E250K probably damaging Het
Nup155 A G 15: 8,177,817 (GRCm39) M1067V probably benign Het
Or4k36 T C 2: 111,145,916 (GRCm39) F31L possibly damaging Het
Pde4d T A 13: 110,084,930 (GRCm39) probably null Het
Rtn4 G A 11: 29,691,011 (GRCm39) V1101I probably damaging Het
Sema6a A G 18: 47,381,595 (GRCm39) V958A possibly damaging Het
Sez6l2 A G 7: 126,566,002 (GRCm39) Y677C probably damaging Het
Smad5 T C 13: 56,883,654 (GRCm39) C347R probably damaging Het
Smim19 A G 8: 22,953,383 (GRCm39) Y95H probably benign Het
Srrm2 C A 17: 24,037,450 (GRCm39) probably benign Het
Ssb A G 2: 69,701,474 (GRCm39) K390E probably damaging Het
Tars1 G A 15: 11,392,068 (GRCm39) T248M probably damaging Het
Tcirg1 A T 19: 3,948,858 (GRCm39) F442L probably damaging Het
Tex55 A G 16: 38,648,336 (GRCm39) Y258H probably benign Het
Tlk2 A G 11: 105,112,133 (GRCm39) E162G probably benign Het
Tmc6 A G 11: 117,660,271 (GRCm39) C656R probably damaging Het
Ttn G T 2: 76,719,406 (GRCm39) probably benign Het
Uqcrc2 C T 7: 120,244,461 (GRCm39) T201I probably damaging Het
Zfp282 G T 6: 47,867,579 (GRCm39) A252S possibly damaging Het
Zfp473 G C 7: 44,383,575 (GRCm39) P253A probably benign Het
Zfp541 A G 7: 15,824,786 (GRCm39) N1068D probably damaging Het
Zfp946 A G 17: 22,674,365 (GRCm39) Q373R probably damaging Het
Zmat2 G A 18: 36,927,010 (GRCm39) G6R probably benign Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36,593,001 (GRCm39) critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36,592,110 (GRCm39) missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36,592,166 (GRCm39) missense probably damaging 1.00
IGL02262:Sema4c APN 1 36,589,422 (GRCm39) missense probably damaging 1.00
IGL02282:Sema4c APN 1 36,589,284 (GRCm39) splice site probably null
IGL02476:Sema4c APN 1 36,595,031 (GRCm39) missense probably damaging 0.98
IGL02900:Sema4c APN 1 36,589,826 (GRCm39) nonsense probably null
swirl UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36,591,965 (GRCm39) missense probably damaging 1.00
R0427:Sema4c UTSW 1 36,592,892 (GRCm39) nonsense probably null
R0497:Sema4c UTSW 1 36,588,689 (GRCm39) missense probably benign 0.04
R1066:Sema4c UTSW 1 36,589,281 (GRCm39) missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36,591,191 (GRCm39) missense probably damaging 1.00
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1639:Sema4c UTSW 1 36,592,615 (GRCm39) missense probably benign 0.00
R1644:Sema4c UTSW 1 36,589,885 (GRCm39) missense probably damaging 1.00
R3176:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3276:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3277:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3551:Sema4c UTSW 1 36,592,804 (GRCm39) missense probably benign 0.02
R4452:Sema4c UTSW 1 36,592,837 (GRCm39) missense probably benign 0.31
R4883:Sema4c UTSW 1 36,591,097 (GRCm39) missense probably damaging 0.98
R4895:Sema4c UTSW 1 36,592,651 (GRCm39) splice site probably null
R4913:Sema4c UTSW 1 36,589,266 (GRCm39) missense probably benign 0.11
R4944:Sema4c UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
R5062:Sema4c UTSW 1 36,592,059 (GRCm39) critical splice donor site probably null
R5077:Sema4c UTSW 1 36,590,812 (GRCm39) missense probably benign 0.20
R5109:Sema4c UTSW 1 36,591,381 (GRCm39) frame shift probably null
R5208:Sema4c UTSW 1 36,589,407 (GRCm39) missense probably damaging 1.00
R5912:Sema4c UTSW 1 36,593,469 (GRCm39) missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36,589,834 (GRCm39) missense probably benign 0.02
R7111:Sema4c UTSW 1 36,592,160 (GRCm39) missense possibly damaging 0.48
R7141:Sema4c UTSW 1 36,592,101 (GRCm39) missense probably damaging 0.99
R7252:Sema4c UTSW 1 36,589,096 (GRCm39) missense probably damaging 1.00
R7495:Sema4c UTSW 1 36,589,774 (GRCm39) missense probably benign 0.00
R7891:Sema4c UTSW 1 36,588,995 (GRCm39) missense probably damaging 0.98
R7895:Sema4c UTSW 1 36,592,199 (GRCm39) missense probably damaging 1.00
R8264:Sema4c UTSW 1 36,591,966 (GRCm39) missense probably damaging 1.00
R8478:Sema4c UTSW 1 36,590,871 (GRCm39) missense probably benign 0.04
R8680:Sema4c UTSW 1 36,589,867 (GRCm39) missense probably benign 0.00
R8733:Sema4c UTSW 1 36,591,954 (GRCm39) missense probably damaging 1.00
R9017:Sema4c UTSW 1 36,592,079 (GRCm39) missense probably damaging 1.00
R9344:Sema4c UTSW 1 36,592,395 (GRCm39) missense probably damaging 1.00
R9488:Sema4c UTSW 1 36,591,067 (GRCm39) missense probably benign
X0019:Sema4c UTSW 1 36,592,077 (GRCm39) missense probably damaging 1.00
X0028:Sema4c UTSW 1 36,589,047 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTAGCCATTGTCTCGGTGC -3'
(R):5'- TACCTCATGGTCGTGACTGCTC -3'

Sequencing Primer
(F):5'- CTCGGTGCCAGTTGTTGATACAC -3'
(R):5'- ATGGTCGTGACTGCTCCATACTAAG -3'
Posted On 2016-10-24