Incidental Mutation 'R5551:Sema4c'
ID435105
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
SynonymsSemaf, Semacl1, M-Sema F, Semacl1, Semai
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location36548639-36558349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36552317 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 348 (Y348H)
Ref Sequence ENSEMBL: ENSMUSP00000141527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001172] [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000195339] [ENSMUST00000195620]
Predicted Effect probably benign
Transcript: ENSMUST00000001172
SMART Domains Protein: ENSMUSP00000001172
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 8.77e2 SMART
ANK 63 92 1.08e-5 SMART
ANK 96 127 1.27e-2 SMART
ANK 129 158 5.62e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114991
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: Y348H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191642
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: Y348H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191677
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: Y348H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191785
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195160
Predicted Effect probably benign
Transcript: ENSMUST00000195339
Predicted Effect probably damaging
Transcript: ENSMUST00000195620
AA Change: Y348H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: Y348H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36553920 critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36553029 missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36553085 missense probably damaging 1.00
IGL02262:Sema4c APN 1 36550341 missense probably damaging 1.00
IGL02282:Sema4c APN 1 36550203 unclassified probably null
IGL02476:Sema4c APN 1 36555950 missense probably damaging 0.98
IGL02900:Sema4c APN 1 36550745 nonsense probably null
swirl UTSW 1 36550311 missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36552884 missense probably damaging 1.00
R0427:Sema4c UTSW 1 36553811 nonsense probably null
R0497:Sema4c UTSW 1 36549608 missense probably benign 0.04
R1066:Sema4c UTSW 1 36550200 missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36552110 missense probably damaging 1.00
R1146:Sema4c UTSW 1 36550565 missense probably benign 0.04
R1146:Sema4c UTSW 1 36550565 missense probably benign 0.04
R1639:Sema4c UTSW 1 36553534 missense probably benign 0.00
R1644:Sema4c UTSW 1 36550804 missense probably damaging 1.00
R3176:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3276:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3277:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3551:Sema4c UTSW 1 36553723 missense probably benign 0.02
R4452:Sema4c UTSW 1 36553756 missense probably benign 0.31
R4883:Sema4c UTSW 1 36552016 missense probably damaging 0.98
R4895:Sema4c UTSW 1 36553570 splice site probably null
R4913:Sema4c UTSW 1 36550185 missense probably benign 0.11
R4944:Sema4c UTSW 1 36550311 missense probably damaging 1.00
R5062:Sema4c UTSW 1 36552978 critical splice donor site probably null
R5077:Sema4c UTSW 1 36551731 missense probably benign 0.20
R5109:Sema4c UTSW 1 36552300 frame shift probably null
R5208:Sema4c UTSW 1 36550326 missense probably damaging 1.00
R5912:Sema4c UTSW 1 36554388 missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36550753 missense probably benign 0.02
R7111:Sema4c UTSW 1 36553079 missense possibly damaging 0.48
R7141:Sema4c UTSW 1 36553020 missense probably damaging 0.99
R7252:Sema4c UTSW 1 36550015 missense probably damaging 1.00
R7495:Sema4c UTSW 1 36550693 missense probably benign 0.00
X0019:Sema4c UTSW 1 36552996 missense probably damaging 1.00
X0028:Sema4c UTSW 1 36549966 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTAGCCATTGTCTCGGTGC -3'
(R):5'- TACCTCATGGTCGTGACTGCTC -3'

Sequencing Primer
(F):5'- CTCGGTGCCAGTTGTTGATACAC -3'
(R):5'- ATGGTCGTGACTGCTCCATACTAAG -3'
Posted On2016-10-24