Incidental Mutation 'R5551:Ssb'
ID435109
Institutional Source Beutler Lab
Gene Symbol Ssb
Ensembl Gene ENSMUSG00000068882
Gene NameSjogren syndrome antigen B
SynonymsSS-B, autoantigen La, La protein
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69861562-69871846 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69871130 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 390 (K390E)
Ref Sequence ENSEMBL: ENSMUSP00000130313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060447] [ENSMUST00000090852] [ENSMUST00000112260] [ENSMUST00000132186] [ENSMUST00000142127] [ENSMUST00000166411]
Predicted Effect probably benign
Transcript: ENSMUST00000060447
SMART Domains Protein: ENSMUSP00000050907
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 184 1.8e-12 PFAM
Pfam:UPF0020 25 170 3.8e-8 PFAM
Pfam:PrmA 35 127 8.4e-14 PFAM
Pfam:MTS 36 174 2.2e-16 PFAM
Pfam:Methyltransf_31 49 199 4e-15 PFAM
Pfam:Methyltransf_18 51 171 8.1e-11 PFAM
Pfam:Methyltransf_15 52 179 1.1e-9 PFAM
Pfam:Methyltransf_26 52 182 3.9e-8 PFAM
Pfam:Methyltransf_25 55 171 5.2e-8 PFAM
Pfam:Methyltransf_11 56 131 8e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090852
AA Change: K390E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088365
Gene: ENSMUSG00000068882
AA Change: K390E

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Pfam:RRM_3 230 333 2.2e-32 PFAM
low complexity region 375 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112260
SMART Domains Protein: ENSMUSP00000107879
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132186
SMART Domains Protein: ENSMUSP00000119773
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
Pfam:RRM_1 113 154 2.6e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000132603
AA Change: K204E
SMART Domains Protein: ENSMUSP00000115666
Gene: ENSMUSG00000068882
AA Change: K204E

DomainStartEndE-ValueType
Pfam:RRM_3 46 149 2.5e-33 PFAM
low complexity region 190 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135459
Predicted Effect probably benign
Transcript: ENSMUST00000142127
SMART Domains Protein: ENSMUSP00000121474
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 141 8.7e-12 PFAM
Pfam:UPF0020 24 141 1.4e-11 PFAM
Pfam:Methyltransf_16 31 126 5e-7 PFAM
Pfam:PrmA 34 127 4e-15 PFAM
Pfam:MTS 35 141 1.4e-17 PFAM
Pfam:Methyltransf_31 49 142 5.2e-15 PFAM
Pfam:Methyltransf_18 51 141 1.4e-11 PFAM
Pfam:Methyltransf_15 52 140 4.5e-9 PFAM
Pfam:Methyltransf_26 52 140 1.3e-14 PFAM
Pfam:Methyltransf_25 55 142 4.7e-8 PFAM
Pfam:Methyltransf_11 56 134 3.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156057
Predicted Effect probably damaging
Transcript: ENSMUST00000166411
AA Change: K390E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130313
Gene: ENSMUSG00000068882
AA Change: K390E

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Pfam:RRM_3 230 333 1.9e-35 PFAM
low complexity region 375 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in diverse aspects of RNA metabolism, including binding and protecting poly(U) termini of nascent RNA polymerase III transcripts from exonuclease digestion, processing 5' and 3' ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. Autoantibodies reacting with this protein are found in the sera of patients with Sjogren syndrome and systemic lupus erythematosus. Alternative promoter usage results in two different transcript variants which encode the same protein. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos, possible before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Ssb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ssb APN 2 69866262 missense probably benign 0.06
IGL00940:Ssb APN 2 69870835 critical splice donor site probably null
IGL00941:Ssb APN 2 69870835 critical splice donor site probably null
IGL01834:Ssb APN 2 69870803 missense possibly damaging 0.89
R0713:Ssb UTSW 2 69867359 missense probably benign 0.06
R0716:Ssb UTSW 2 69867359 missense probably benign 0.06
R0751:Ssb UTSW 2 69870565 missense probably benign
R1139:Ssb UTSW 2 69866576 missense possibly damaging 0.66
R1928:Ssb UTSW 2 69867557 splice site probably null
R2037:Ssb UTSW 2 69868819 missense probably benign 0.16
R3968:Ssb UTSW 2 69867449 splice site probably benign
R4674:Ssb UTSW 2 69868850 missense probably benign 0.01
R5039:Ssb UTSW 2 69866237 missense possibly damaging 0.79
R6102:Ssb UTSW 2 69871208 makesense probably null
R7126:Ssb UTSW 2 69866501 missense possibly damaging 0.70
R7448:Ssb UTSW 2 69863280 missense probably benign
R7590:Ssb UTSW 2 69867290 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCTTGCTTGTATTGTTTCACAAGTG -3'
(R):5'- TTATACAGGTGGACATCGAAGTGG -3'

Sequencing Primer
(F):5'- CTTGTATTGTTTCACAAGTGAGAGG -3'
(R):5'- TCGAAGTGGACCTAATTCGC -3'
Posted On2016-10-24