Incidental Mutation 'R5551:Csmd2'
ID435117
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128510948 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 2376 (Y2376H)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000184063
AA Change: Y2376H

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
Predicted Primers PCR Primer
(F):5'- ATGAGGTTACTGCCTGCCATG -3'
(R):5'- ACTGAGGGAAAGCTGTTGC -3'

Sequencing Primer
(F):5'- CCATGGGGCAGTATAACGGC -3'
(R):5'- CTGTCTGTAGCGGGGAAC -3'
Posted On2016-10-24