Mutagenetix > Incidental Mutation

Incidental Mutation 'R5551:Hook3'

435129

Institutional Source

Beutler Lab

Gene Symbol

Hook3

Ensembl Gene

ENSMUSG00000037234

Gene Name

hook microtubule tethering protein 3

Synonyms

E330005F07Rik, 5830454D03Rik

MMRRC Submission

043108-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5551 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26021421-26119224 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26068611 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 75 (F75S)

Ref Sequence

ENSEMBL: ENSMUSP00000115008 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]

AlphaFold

Q8BUK6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037182
AA Change: F394S

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: F394S

Domain	Start	End	E-Value	Type
Pfam:HOOK	12	710	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147613
AA Change: F75S

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234
AA Change: F75S

Domain	Start	End	E-Value	Type
Pfam:HOOK	1	194	1.1e-75	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210172

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210389

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210860

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930435E12Rik	A	G	16: 38,827,974	Y258H	probably benign	Het
AB041806	G	T	4: 138,396,001	P3T	probably damaging	Het
Abl1	C	T	2: 31,801,670	A1048V	probably benign	Het
Acap2	A	G	16: 31,104,908	V659A	probably damaging	Het
Acox1	A	G	11: 116,189,491	S29P	possibly damaging	Het
Adamts1	A	G	16: 85,797,746	I405T	probably benign	Het
Afm	A	T	5: 90,531,652	E335V	probably null	Het
Akap6	C	T	12: 52,795,964	P32S	probably damaging	Het
Alk	T	C	17: 71,875,033	M1332V	possibly damaging	Het
Ankrd39	C	T	1: 36,541,981	G96R	probably damaging	Het
Atp2c1	C	A	9: 105,459,737	A16S	probably damaging	Het
Ccdc141	T	C	2: 77,014,409	E1438G	probably damaging	Het
Csmd2	T	C	4: 128,510,948	Y2376H	possibly damaging	Het
Csmd3	T	C	15: 48,314,096	T349A	probably benign	Het
Ctsr	A	T	13: 61,159,543	M313K	probably damaging	Het
D430042O09Rik	T	C	7: 125,820,077	F472S	probably damaging	Het
Dot1l	CCAGCCCCACCCTCAGCC	CCAGCC	10: 80,783,628		probably benign	Het
Dync2h1	A	G	9: 7,031,718	S3516P	possibly damaging	Het
Ehd4	A	G	2: 120,127,619	S162P	possibly damaging	Het
Ets2	T	C	16: 95,712,121	W114R	probably damaging	Het
Fignl1	A	T	11: 11,801,603	V484E	probably damaging	Het
Golph3	C	A	15: 12,321,836	S35R	probably benign	Het
Gzf1	T	C	2: 148,684,328	Y240H	probably damaging	Het
Ifi209	T	A	1: 173,641,197	S198T	probably benign	Het
Iqch	A	T	9: 63,496,253		probably null	Het
Lrrk2	C	T	15: 91,812,350	T2447I	probably benign	Het
Mesp2	T	C	7: 79,811,619	S231P	probably benign	Het
Muc5b	T	C	7: 141,868,503	C4459R	possibly damaging	Het
Myh10	A	G	11: 68,768,287	E497G	possibly damaging	Het
Nalcn	A	T	14: 123,278,286	V1701E	possibly damaging	Het
Nat8f1	T	C	6: 85,910,909	D23G	probably damaging	Het
Nfia	G	A	4: 98,014,260	E250K	probably damaging	Het
Nup155	A	G	15: 8,148,333	M1067V	probably benign	Het
Olfr1280	T	C	2: 111,315,571	F31L	possibly damaging	Het
Pde4d	T	A	13: 109,948,396		probably null	Het
Rtn4	G	A	11: 29,741,011	V1101I	probably damaging	Het
Sema4c	A	G	1: 36,552,317	Y348H	probably damaging	Het
Sema6a	A	G	18: 47,248,528	V958A	possibly damaging	Het
Sez6l2	A	G	7: 126,966,830	Y677C	probably damaging	Het
Smad5	T	C	13: 56,735,841	C347R	probably damaging	Het
Smim19	A	G	8: 22,463,367	Y95H	probably benign	Het
Srrm2	C	A	17: 23,818,476		probably benign	Het
Ssb	A	G	2: 69,871,130	K390E	probably damaging	Het
Tars	G	A	15: 11,391,982	T248M	probably damaging	Het
Tcirg1	A	T	19: 3,898,858	F442L	probably damaging	Het
Tlk2	A	G	11: 105,221,307	E162G	probably benign	Het
Tmc6	A	G	11: 117,769,445	C656R	probably damaging	Het
Ttn	G	T	2: 76,889,062		probably benign	Het
Uqcrc2	C	T	7: 120,645,238	T201I	probably damaging	Het
Zfp282	G	T	6: 47,890,645	A252S	possibly damaging	Het
Zfp473	G	C	7: 44,734,151	P253A	probably benign	Het
Zfp541	A	G	7: 16,090,861	N1068D	probably damaging	Het
Zfp946	A	G	17: 22,455,384	Q373R	probably damaging	Het
Zmat2	G	A	18: 36,793,957	G6R	probably benign	Het

Other mutations in Hook3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Hook3	APN	8	26059250	missense	possibly damaging	0.46
IGL01066:Hook3	APN	8	26048298	missense	probably damaging	1.00
IGL01145:Hook3	APN	8	26059344	missense	probably benign	0.00
IGL01514:Hook3	APN	8	26088189	missense	possibly damaging	0.69
IGL01727:Hook3	APN	8	26070159	missense	probably benign	0.00
IGL01832:Hook3	APN	8	26072365	missense	possibly damaging	0.87
IGL01874:Hook3	APN	8	26039732	missense	possibly damaging	0.71
IGL01931:Hook3	APN	8	26088055	splice site	probably benign
IGL01948:Hook3	APN	8	26059312	missense	possibly damaging	0.95
IGL02209:Hook3	APN	8	26070265	missense	probably damaging	0.99
IGL02675:Hook3	APN	8	26061434	missense	possibly damaging	0.64
IGL02750:Hook3	APN	8	26095754	splice site	probably benign
Rufio	UTSW	8	26034940	nonsense	probably null
R0384:Hook3	UTSW	8	26044235	splice site	probably null
R0600:Hook3	UTSW	8	26118986	missense	probably benign
R1037:Hook3	UTSW	8	26072350	missense	possibly damaging	0.92
R1413:Hook3	UTSW	8	26038106	missense	probably damaging	0.98
R1563:Hook3	UTSW	8	26110752	missense	probably benign	0.06
R1767:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R1806:Hook3	UTSW	8	26068659	missense	probably damaging	1.00
R2025:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2026:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2027:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2091:Hook3	UTSW	8	26059394	splice site	probably benign
R2153:Hook3	UTSW	8	26070197	missense	probably damaging	1.00
R2184:Hook3	UTSW	8	26118983	missense	probably benign	0.00
R4586:Hook3	UTSW	8	26032011	missense	probably damaging	0.98
R4863:Hook3	UTSW	8	26038029	missense	probably damaging	1.00
R4971:Hook3	UTSW	8	26082579	missense	probably benign	0.22
R5023:Hook3	UTSW	8	26032019	frame shift	probably null
R5026:Hook3	UTSW	8	26110757	missense	probably damaging	0.98
R5068:Hook3	UTSW	8	26095757	critical splice donor site	probably null
R5253:Hook3	UTSW	8	26072291	missense	probably benign
R5383:Hook3	UTSW	8	26118989	missense	probably benign	0.01
R5437:Hook3	UTSW	8	26061422	missense	probably benign	0.05
R5528:Hook3	UTSW	8	26072293	missense	probably damaging	1.00
R5846:Hook3	UTSW	8	26044327	intron	probably benign
R5907:Hook3	UTSW	8	26044278	intron	probably benign
R6082:Hook3	UTSW	8	26110785	missense	probably benign	0.00
R6124:Hook3	UTSW	8	26059272	missense	probably benign	0.20
R6301:Hook3	UTSW	8	26034940	nonsense	probably null
R6314:Hook3	UTSW	8	26088108	missense	probably benign
R6448:Hook3	UTSW	8	26093664	missense	probably benign	0.02
R6810:Hook3	UTSW	8	26032422	splice site	probably null
R7168:Hook3	UTSW	8	26071086	missense	probably benign	0.02
R7856:Hook3	UTSW	8	26035221	missense	probably damaging	1.00
R7988:Hook3	UTSW	8	26073647	missense	probably benign	0.02
R8079:Hook3	UTSW	8	26088058	critical splice donor site	probably null
R9121:Hook3	UTSW	8	26035167	missense	probably damaging	1.00
R9223:Hook3	UTSW	8	26032524	missense
R9244:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R9246:Hook3	UTSW	8	26072291	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAACAGTATCCTCCACGGG -3'
(R):5'- GGTGTTGAGCATATGAGGCC -3'

Sequencing Primer
(F):5'- GTATCCTCCACGGGAATTACAC -3'
(R):5'- GAGCATATGAGGCCTTTGTACACAC -3'

Posted On

2016-10-24