Incidental Mutation 'R5551:Iqch'
ID435132
Institutional Source Beutler Lab
Gene Symbol Iqch
Ensembl Gene ENSMUSG00000037801
Gene NameIQ motif containing H
Synonyms4921504K03Rik
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location63421455-63602493 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 63496253 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042322] [ENSMUST00000080527] [ENSMUST00000163624] [ENSMUST00000163982] [ENSMUST00000171243]
Predicted Effect probably null
Transcript: ENSMUST00000042322
SMART Domains Protein: ENSMUSP00000047953
Gene: ENSMUSG00000037801

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000080527
SMART Domains Protein: ENSMUSP00000079370
Gene: ENSMUSG00000037801

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126238
Predicted Effect probably null
Transcript: ENSMUST00000163624
SMART Domains Protein: ENSMUSP00000128482
Gene: ENSMUSG00000037801

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163982
SMART Domains Protein: ENSMUSP00000126546
Gene: ENSMUSG00000037801

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171243
SMART Domains Protein: ENSMUSP00000131828
Gene: ENSMUSG00000037801

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
IQ 366 388 2.79e0 SMART
low complexity region 440 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191455
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Iqch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Iqch APN 9 63480654 missense probably damaging 0.96
IGL01472:Iqch APN 9 63547934 missense probably benign 0.02
IGL01553:Iqch APN 9 63500917 missense probably benign 0.00
IGL01611:Iqch APN 9 63496237 critical splice acceptor site probably null
IGL02608:Iqch APN 9 63421828 unclassified probably benign
IGL03060:Iqch APN 9 63524914 missense probably damaging 1.00
IGL03154:Iqch APN 9 63454682 missense probably damaging 0.97
I2288:Iqch UTSW 9 63500890 missense probably benign 0.01
R0002:Iqch UTSW 9 63594743 splice site probably benign
R0350:Iqch UTSW 9 63500876 missense probably benign 0.43
R0532:Iqch UTSW 9 63508232 splice site probably benign
R0629:Iqch UTSW 9 63425382 missense probably benign 0.22
R0710:Iqch UTSW 9 63525136 missense probably benign
R0766:Iqch UTSW 9 63482683 missense probably benign 0.02
R1797:Iqch UTSW 9 63588377 missense possibly damaging 0.58
R1856:Iqch UTSW 9 63534337 splice site probably null
R1954:Iqch UTSW 9 63548016 missense probably benign 0.00
R1955:Iqch UTSW 9 63548016 missense probably benign 0.00
R2184:Iqch UTSW 9 63525069 missense probably damaging 0.99
R2264:Iqch UTSW 9 63512299 missense probably benign 0.27
R4614:Iqch UTSW 9 63482581 missense probably benign
R4643:Iqch UTSW 9 63594802 missense probably benign 0.00
R4654:Iqch UTSW 9 63524913 missense probably damaging 0.99
R4665:Iqch UTSW 9 63445571 missense probably damaging 1.00
R5027:Iqch UTSW 9 63525012 missense possibly damaging 0.87
R5042:Iqch UTSW 9 63496234 missense possibly damaging 0.48
R5829:Iqch UTSW 9 63425357 critical splice donor site probably null
R5878:Iqch UTSW 9 63547990 missense probably damaging 0.99
R6816:Iqch UTSW 9 63480759 missense probably benign 0.02
R6930:Iqch UTSW 9 63480574 missense possibly damaging 0.79
R7000:Iqch UTSW 9 63454610 missense probably benign
R7026:Iqch UTSW 9 63525139 nonsense probably null
R7066:Iqch UTSW 9 63524745 missense probably benign 0.24
R7111:Iqch UTSW 9 63512317 missense possibly damaging 0.79
R7129:Iqch UTSW 9 63421909 missense probably benign 0.09
R7177:Iqch UTSW 9 63421835 makesense probably null
R7252:Iqch UTSW 9 63512236 critical splice donor site probably null
R7485:Iqch UTSW 9 63508317 missense possibly damaging 0.47
R7541:Iqch UTSW 9 63445521 missense possibly damaging 0.95
X0066:Iqch UTSW 9 63429058 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTACCACTGAACACTCACTTGTG -3'
(R):5'- AATGGCTTTTATCCCATTGGCTAG -3'

Sequencing Primer
(F):5'- AGTCCTCATGGCCAAATCTG -3'
(R):5'- ATCCCATTGGCTAGTGATTTCTC -3'
Posted On2016-10-24