Incidental Mutation 'R5551:Tlk2'
ID435139
Institutional Source Beutler Lab
Gene Symbol Tlk2
Ensembl Gene ENSMUSG00000020694
Gene Nametousled-like kinase 2 (Arabidopsis)
Synonymsprotein kinase U-alpha, 4933403M19Rik, PKUalpha
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.718) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105178807-105283959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105221307 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 162 (E162G)
Ref Sequence ENSEMBL: ENSMUSP00000090198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015107] [ENSMUST00000092537] [ENSMUST00000106939] [ENSMUST00000106941] [ENSMUST00000126175] [ENSMUST00000145048]
Predicted Effect probably benign
Transcript: ENSMUST00000015107
AA Change: E130G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000015107
Gene: ENSMUSG00000020694
AA Change: E130G

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 202 237 N/A INTRINSIC
coiled coil region 285 314 N/A INTRINSIC
coiled coil region 355 393 N/A INTRINSIC
S_TKc 408 687 1.63e-78 SMART
low complexity region 696 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092537
AA Change: E162G

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000090198
Gene: ENSMUSG00000020694
AA Change: E162G

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
coiled coil region 234 269 N/A INTRINSIC
coiled coil region 317 346 N/A INTRINSIC
coiled coil region 387 425 N/A INTRINSIC
Pfam:Pkinase 440 675 9.4e-52 PFAM
Pfam:Pkinase_Tyr 441 669 3.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106939
AA Change: E130G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102552
Gene: ENSMUSG00000020694
AA Change: E130G

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 202 237 N/A INTRINSIC
coiled coil region 285 314 N/A INTRINSIC
coiled coil region 355 393 N/A INTRINSIC
S_TKc 408 687 1.63e-78 SMART
low complexity region 696 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106941
AA Change: E162G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102554
Gene: ENSMUSG00000020694
AA Change: E162G

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
coiled coil region 234 269 N/A INTRINSIC
coiled coil region 317 346 N/A INTRINSIC
coiled coil region 387 425 N/A INTRINSIC
S_TKc 440 719 1.63e-78 SMART
low complexity region 728 749 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123050
Predicted Effect probably benign
Transcript: ENSMUST00000126175
SMART Domains Protein: ENSMUSP00000120944
Gene: ENSMUSG00000020694

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145048
AA Change: E130G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118520
Gene: ENSMUSG00000020694
AA Change: E130G

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 170 205 N/A INTRINSIC
coiled coil region 253 282 N/A INTRINSIC
coiled coil region 323 361 N/A INTRINSIC
Pfam:Pkinase 376 611 2.4e-51 PFAM
Pfam:Pkinase_Tyr 377 605 8.5e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152404
AA Change: E110G
SMART Domains Protein: ENSMUSP00000123179
Gene: ENSMUSG00000020694
AA Change: E110G

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear serine/threonine kinase that was first identified in Arabidopsis. The encoded protein is thought to function in the regulation of chromatin assembly in the S phase of the cell cycle by regulating the levels of a histone H3/H4 chaperone. This protein is associated with double-strand break repair of DNA damage caused by radiation. Pseudogenes of this gene are present on chromosomes 10 and 17. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sema6a A G 18: 47,248,528 V958A possibly damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Tlk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Tlk2 APN 11 105246795 nonsense probably null
IGL00956:Tlk2 APN 11 105247592 missense probably benign 0.01
IGL01083:Tlk2 APN 11 105221224 missense probably benign 0.11
IGL02523:Tlk2 APN 11 105275947 missense probably damaging 0.99
IGL02694:Tlk2 APN 11 105221235 missense probably benign 0.19
H8786:Tlk2 UTSW 11 105254979 missense possibly damaging 0.93
PIT4378001:Tlk2 UTSW 11 105281220 missense unknown
R0310:Tlk2 UTSW 11 105254973 missense probably benign 0.15
R1457:Tlk2 UTSW 11 105256952 critical splice donor site probably null
R1505:Tlk2 UTSW 11 105260295 missense probably damaging 1.00
R1856:Tlk2 UTSW 11 105221298 missense probably benign 0.00
R2069:Tlk2 UTSW 11 105240440 missense probably benign 0.22
R2305:Tlk2 UTSW 11 105241591 missense possibly damaging 0.47
R2351:Tlk2 UTSW 11 105209830 missense probably damaging 1.00
R3724:Tlk2 UTSW 11 105247564 missense probably benign 0.01
R4607:Tlk2 UTSW 11 105255018 missense probably damaging 1.00
R4641:Tlk2 UTSW 11 105275983 missense probably benign 0.41
R4738:Tlk2 UTSW 11 105256882 missense probably benign 0.22
R4803:Tlk2 UTSW 11 105281100 missense probably damaging 1.00
R4957:Tlk2 UTSW 11 105253359 critical splice donor site probably null
R5407:Tlk2 UTSW 11 105240375 missense probably damaging 0.98
R6456:Tlk2 UTSW 11 105221273 missense probably benign 0.05
R6922:Tlk2 UTSW 11 105256953 critical splice donor site probably null
R7183:Tlk2 UTSW 11 105221359 splice site probably null
R7265:Tlk2 UTSW 11 105184244 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCATGTTGTCAGTACTGATTACC -3'
(R):5'- CTGAGTGAAGTACTGGTAATGCC -3'

Sequencing Primer
(F):5'- GATTACCCTTTCTTACATCAGCTGTG -3'
(R):5'- TGTGCTGCTCTGACAGAAGACTC -3'
Posted On2016-10-24