Incidental Mutation 'R5551:Sema6a'
List |< first << previous [record 39 of 55] next >> last >|
ID435158
Institutional Source Beutler Lab
Gene Symbol Sema6a
Ensembl Gene ENSMUSG00000019647
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonymssema, Sema6A-1, Semaq, A730020P05Rik, VIa
MMRRC Submission 043108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5551 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location47235598-47368870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47248528 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 958 (V958A)
Ref Sequence ENSEMBL: ENSMUSP00000111109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019791] [ENSMUST00000076043] [ENSMUST00000115449] [ENSMUST00000135790] [ENSMUST00000156422]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019791
AA Change: V984A

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019791
Gene: ENSMUSG00000019647
AA Change: V984A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076043
AA Change: V929A

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075420
Gene: ENSMUSG00000019647
AA Change: V929A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 593 615 N/A INTRINSIC
low complexity region 877 896 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115449
AA Change: V958A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111109
Gene: ENSMUSG00000019647
AA Change: V958A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 461 1.24e-168 SMART
PSI 488 543 9.57e-1 SMART
transmembrane domain 622 644 N/A INTRINSIC
low complexity region 906 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123228
SMART Domains Protein: ENSMUSP00000120249
Gene: ENSMUSG00000019647

DomainStartEndE-ValueType
Blast:PSI 2 45 4e-26 BLAST
PDB:3OKY|B 2 47 2e-26 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000135790
AA Change: V1001A

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120011
Gene: ENSMUSG00000019647
AA Change: V1001A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156422
AA Change: V984A

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121442
Gene: ENSMUSG00000019647
AA Change: V984A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transmembrane semaphorin SEMA6A is expressed in developing neural tissue and is required for proper development of the thalamocortical projection (Leighton et al., 2001 [PubMed 11242070]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit defects in lamina-specific neurite stratification of specific retinal neuron subtypes and disruption of the dendritic plexus organization of On but not Off starburst amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,974 Y258H probably benign Het
AB041806 G T 4: 138,396,001 P3T probably damaging Het
Abl1 C T 2: 31,801,670 A1048V probably benign Het
Acap2 A G 16: 31,104,908 V659A probably damaging Het
Acox1 A G 11: 116,189,491 S29P possibly damaging Het
Adamts1 A G 16: 85,797,746 I405T probably benign Het
Afm A T 5: 90,531,652 E335V probably null Het
Akap6 C T 12: 52,795,964 P32S probably damaging Het
Alk T C 17: 71,875,033 M1332V possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Atp2c1 C A 9: 105,459,737 A16S probably damaging Het
Ccdc141 T C 2: 77,014,409 E1438G probably damaging Het
Csmd2 T C 4: 128,510,948 Y2376H possibly damaging Het
Csmd3 T C 15: 48,314,096 T349A probably benign Het
Ctsr A T 13: 61,159,543 M313K probably damaging Het
D430042O09Rik T C 7: 125,820,077 F472S probably damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dync2h1 A G 9: 7,031,718 S3516P possibly damaging Het
Ehd4 A G 2: 120,127,619 S162P possibly damaging Het
Ets2 T C 16: 95,712,121 W114R probably damaging Het
Fignl1 A T 11: 11,801,603 V484E probably damaging Het
Golph3 C A 15: 12,321,836 S35R probably benign Het
Gzf1 T C 2: 148,684,328 Y240H probably damaging Het
Hook3 A G 8: 26,068,611 F75S possibly damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Iqch A T 9: 63,496,253 probably null Het
Lrrk2 C T 15: 91,812,350 T2447I probably benign Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Muc5b T C 7: 141,868,503 C4459R possibly damaging Het
Myh10 A G 11: 68,768,287 E497G possibly damaging Het
Nalcn A T 14: 123,278,286 V1701E possibly damaging Het
Nat8f1 T C 6: 85,910,909 D23G probably damaging Het
Nfia G A 4: 98,014,260 E250K probably damaging Het
Nup155 A G 15: 8,148,333 M1067V probably benign Het
Olfr1280 T C 2: 111,315,571 F31L possibly damaging Het
Pde4d T A 13: 109,948,396 probably null Het
Rtn4 G A 11: 29,741,011 V1101I probably damaging Het
Sema4c A G 1: 36,552,317 Y348H probably damaging Het
Sez6l2 A G 7: 126,966,830 Y677C probably damaging Het
Smad5 T C 13: 56,735,841 C347R probably damaging Het
Smim19 A G 8: 22,463,367 Y95H probably benign Het
Srrm2 C A 17: 23,818,476 probably benign Het
Ssb A G 2: 69,871,130 K390E probably damaging Het
Tars G A 15: 11,391,982 T248M probably damaging Het
Tcirg1 A T 19: 3,898,858 F442L probably damaging Het
Tlk2 A G 11: 105,221,307 E162G probably benign Het
Tmc6 A G 11: 117,769,445 C656R probably damaging Het
Ttn G T 2: 76,889,062 probably benign Het
Uqcrc2 C T 7: 120,645,238 T201I probably damaging Het
Zfp282 G T 6: 47,890,645 A252S possibly damaging Het
Zfp473 G C 7: 44,734,151 P253A probably benign Het
Zfp541 A G 7: 16,090,861 N1068D probably damaging Het
Zfp946 A G 17: 22,455,384 Q373R probably damaging Het
Zmat2 G A 18: 36,793,957 G6R probably benign Het
Other mutations in Sema6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Sema6a APN 18 47289975 critical splice donor site probably null
IGL01351:Sema6a APN 18 47281302 missense possibly damaging 0.84
IGL01594:Sema6a APN 18 47248817 missense probably damaging 1.00
IGL01953:Sema6a APN 18 47290120 nonsense probably null
IGL02077:Sema6a APN 18 47283398 missense possibly damaging 0.94
IGL02632:Sema6a APN 18 47290155 missense probably damaging 1.00
IGL02957:Sema6a APN 18 47249224 missense probably damaging 1.00
IGL03013:Sema6a APN 18 47248394 missense probably benign 0.01
IGL03279:Sema6a APN 18 47300090 nonsense probably null
saphire UTSW 18 47306429 nonsense probably null
IGL02988:Sema6a UTSW 18 47298214 missense probably damaging 1.00
R0114:Sema6a UTSW 18 47290177 missense probably damaging 1.00
R0311:Sema6a UTSW 18 47290045 unclassified probably null
R0312:Sema6a UTSW 18 47290045 unclassified probably null
R0347:Sema6a UTSW 18 47291129 missense probably damaging 1.00
R0350:Sema6a UTSW 18 47270718 missense probably benign
R0366:Sema6a UTSW 18 47290045 unclassified probably null
R0368:Sema6a UTSW 18 47290045 unclassified probably null
R0391:Sema6a UTSW 18 47290045 unclassified probably null
R0403:Sema6a UTSW 18 47290045 unclassified probably null
R0466:Sema6a UTSW 18 47290045 unclassified probably null
R0515:Sema6a UTSW 18 47290045 unclassified probably null
R0517:Sema6a UTSW 18 47290045 unclassified probably null
R0542:Sema6a UTSW 18 47248576 missense probably damaging 1.00
R0557:Sema6a UTSW 18 47249500 missense probably benign 0.01
R0569:Sema6a UTSW 18 47270805 splice site probably null
R0650:Sema6a UTSW 18 47290045 unclassified probably null
R0689:Sema6a UTSW 18 47290045 unclassified probably null
R0694:Sema6a UTSW 18 47290045 unclassified probably null
R0726:Sema6a UTSW 18 47291981 missense probably damaging 1.00
R0741:Sema6a UTSW 18 47290045 unclassified probably null
R0821:Sema6a UTSW 18 47290045 unclassified probably null
R0824:Sema6a UTSW 18 47290045 unclassified probably null
R0924:Sema6a UTSW 18 47248492 missense probably damaging 1.00
R1108:Sema6a UTSW 18 47306431 missense probably benign 0.02
R1255:Sema6a UTSW 18 47249299 missense probably damaging 0.98
R1422:Sema6a UTSW 18 47306431 missense probably benign 0.02
R1531:Sema6a UTSW 18 47248999 missense probably damaging 1.00
R1707:Sema6a UTSW 18 47283445 missense probably benign 0.04
R1746:Sema6a UTSW 18 47306349 splice site probably benign
R1807:Sema6a UTSW 18 47276424 missense possibly damaging 0.85
R1974:Sema6a UTSW 18 47270629 missense probably benign 0.04
R1987:Sema6a UTSW 18 47300142 missense probably damaging 1.00
R2044:Sema6a UTSW 18 47306429 nonsense probably null
R3719:Sema6a UTSW 18 47249077 missense probably damaging 1.00
R4491:Sema6a UTSW 18 47306457 utr 5 prime probably benign
R4552:Sema6a UTSW 18 47291923 missense probably damaging 1.00
R4707:Sema6a UTSW 18 47248712 missense probably benign 0.43
R4710:Sema6a UTSW 18 47270683 missense probably benign 0.00
R4713:Sema6a UTSW 18 47249296 missense possibly damaging 0.79
R4963:Sema6a UTSW 18 47298251 missense possibly damaging 0.48
R5088:Sema6a UTSW 18 47249129 missense probably damaging 1.00
R5133:Sema6a UTSW 18 47300128 missense probably damaging 1.00
R5135:Sema6a UTSW 18 47291172 missense probably damaging 1.00
R5141:Sema6a UTSW 18 47248388 missense probably damaging 1.00
R5277:Sema6a UTSW 18 47276544 intron probably benign
R5618:Sema6a UTSW 18 47281948 missense probably damaging 0.98
R5717:Sema6a UTSW 18 47249263 missense probably benign 0.01
R5729:Sema6a UTSW 18 47281343 missense probably damaging 1.00
R5779:Sema6a UTSW 18 47248826 missense probably damaging 1.00
R5917:Sema6a UTSW 18 47281338 missense probably benign 0.05
R6054:Sema6a UTSW 18 47283403 missense possibly damaging 0.94
R6142:Sema6a UTSW 18 47281199 missense probably benign 0.00
R6209:Sema6a UTSW 18 47298302 splice site probably null
R6307:Sema6a UTSW 18 47249164 missense probably damaging 1.00
R6734:Sema6a UTSW 18 47279169 missense probably benign 0.31
R7014:Sema6a UTSW 18 47298217 missense probably damaging 1.00
R7033:Sema6a UTSW 18 47248570 missense probably damaging 0.96
R7574:Sema6a UTSW 18 47291164 missense probably damaging 1.00
X0065:Sema6a UTSW 18 47283319 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ATCGGATGCTTCAACTCCTG -3'
(R):5'- AACACTCCTCCTCCTATGGG -3'

Sequencing Primer
(F):5'- ATGCTTCAACTCCTGGCCCC -3'
(R):5'- CCTCCTATGGGCTCGAATATAAGAG -3'
Posted On2016-10-24