Incidental Mutation 'R5552:Mrc1'
ID 435162
Institutional Source Beutler Lab
Gene Symbol Mrc1
Ensembl Gene ENSMUSG00000026712
Gene Name mannose receptor, C type 1
Synonyms CD206, MR
MMRRC Submission 043109-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R5552 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 14234225-14336834 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14284768 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 586 (F586L)
Ref Sequence ENSEMBL: ENSMUSP00000028045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028045]
AlphaFold Q61830
PDB Structure CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028045
AA Change: F586L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: F586L

DomainStartEndE-ValueType
RICIN 22 142 8.09e-18 SMART
FN2 161 209 1.83e-27 SMART
CLECT 216 341 8.87e-26 SMART
CLECT 362 487 3.51e-38 SMART
CLECT 504 626 8.2e-30 SMART
CLECT 646 778 2.34e-34 SMART
CLECT 800 923 2.17e-29 SMART
low complexity region 935 941 N/A INTRINSIC
CLECT 944 1079 3.35e-35 SMART
CLECT 1094 1212 4.11e-21 SMART
CLECT 1229 1355 3.63e-31 SMART
transmembrane domain 1388 1410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,813,530 (GRCm39) Y403H probably benign Het
Ankrd39 C T 1: 36,581,062 (GRCm39) G96R probably damaging Het
Arhgap19 T C 19: 41,772,819 (GRCm39) I291M probably benign Het
Blzf1 A T 1: 164,130,058 (GRCm39) I91N probably damaging Het
Cdh2 T C 18: 16,773,520 (GRCm39) T270A possibly damaging Het
Chd5 T A 4: 152,470,272 (GRCm39) M1906K possibly damaging Het
Cpsf1 T C 15: 76,483,846 (GRCm39) D799G probably benign Het
Csnk1g3 T C 18: 54,065,355 (GRCm39) F313L probably benign Het
Cyfip1 T C 7: 55,521,855 (GRCm39) V53A possibly damaging Het
Dcst1 T C 3: 89,272,373 (GRCm39) D30G probably benign Het
Dlgap2 G T 8: 14,881,342 (GRCm39) G805* probably null Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,619,462 (GRCm39) probably benign Het
Epha8 T C 4: 136,659,210 (GRCm39) N843S probably damaging Het
Evi5 A T 5: 107,966,855 (GRCm39) V222E probably damaging Het
Gli1 C A 10: 127,166,131 (GRCm39) A1041S probably benign Het
Glipr1l1 A T 10: 111,898,243 (GRCm39) Q116L probably benign Het
H3c4 A G 13: 23,760,295 (GRCm39) D107G probably damaging Het
Hectd4 T A 5: 121,480,914 (GRCm39) L2985Q possibly damaging Het
Hk2 G T 6: 82,707,804 (GRCm39) R694S possibly damaging Het
Htt A G 5: 34,979,118 (GRCm39) M834V probably benign Het
Itpr2 A G 6: 146,195,578 (GRCm39) Y1600H probably benign Het
Med1 A T 11: 98,057,157 (GRCm39) Y340* probably null Het
Mov10l1 T A 15: 88,938,569 (GRCm39) probably null Het
Mrrf T A 2: 36,037,973 (GRCm39) D81E possibly damaging Het
Nod1 A G 6: 54,921,616 (GRCm39) F234S probably damaging Het
Odad2 A G 18: 7,285,360 (GRCm39) V267A possibly damaging Het
Or10ak9 T A 4: 118,726,665 (GRCm39) I228N probably damaging Het
Or6c69c T C 10: 129,911,014 (GRCm39) V245A probably damaging Het
Pde4a T C 9: 21,112,682 (GRCm39) V343A probably damaging Het
Pmfbp1 T A 8: 110,258,383 (GRCm39) L649Q probably damaging Het
Polq A G 16: 36,914,872 (GRCm39) I2511V possibly damaging Het
Pramel51 T A 12: 88,145,135 (GRCm39) T64S probably benign Het
Serac1 T A 17: 6,106,967 (GRCm39) R361* probably null Het
Serpina3g T C 12: 104,206,595 (GRCm39) V132A probably damaging Het
Thada A C 17: 84,736,558 (GRCm39) S908A probably benign Het
Zfp280b C T 10: 75,875,497 (GRCm39) Q459* probably null Het
Other mutations in Mrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mrc1 APN 2 14,333,236 (GRCm39) missense probably damaging 1.00
IGL01326:Mrc1 APN 2 14,271,335 (GRCm39) missense probably damaging 1.00
IGL01340:Mrc1 APN 2 14,314,895 (GRCm39) critical splice donor site probably null
IGL01758:Mrc1 APN 2 14,243,059 (GRCm39) missense probably damaging 1.00
IGL01799:Mrc1 APN 2 14,243,187 (GRCm39) missense probably damaging 1.00
IGL02280:Mrc1 APN 2 14,249,024 (GRCm39) missense probably benign 0.19
IGL02435:Mrc1 APN 2 14,253,671 (GRCm39) nonsense probably null
IGL03073:Mrc1 APN 2 14,310,153 (GRCm39) missense probably damaging 1.00
IGL03110:Mrc1 APN 2 14,298,289 (GRCm39) nonsense probably null
IGL03155:Mrc1 APN 2 14,335,912 (GRCm39) missense probably benign 0.00
IGL03289:Mrc1 APN 2 14,313,634 (GRCm39) critical splice donor site probably null
amlodipine UTSW 2 14,275,016 (GRCm39) missense probably damaging 1.00
losartan UTSW 2 14,299,597 (GRCm39) splice site probably null
Shug UTSW 2 14,275,017 (GRCm39) missense probably damaging 1.00
sussigkeit UTSW 2 14,330,192 (GRCm39) splice site probably null
R0011:Mrc1 UTSW 2 14,266,148 (GRCm39) critical splice donor site probably null
R0011:Mrc1 UTSW 2 14,266,148 (GRCm39) critical splice donor site probably null
R0066:Mrc1 UTSW 2 14,266,011 (GRCm39) missense probably benign 0.42
R0066:Mrc1 UTSW 2 14,266,011 (GRCm39) missense probably benign 0.42
R0110:Mrc1 UTSW 2 14,243,353 (GRCm39) splice site probably benign
R0234:Mrc1 UTSW 2 14,284,705 (GRCm39) missense possibly damaging 0.65
R0234:Mrc1 UTSW 2 14,284,705 (GRCm39) missense possibly damaging 0.65
R0381:Mrc1 UTSW 2 14,312,720 (GRCm39) missense probably benign 0.05
R0505:Mrc1 UTSW 2 14,314,843 (GRCm39) missense probably damaging 1.00
R0539:Mrc1 UTSW 2 14,274,937 (GRCm39) splice site probably benign
R0613:Mrc1 UTSW 2 14,299,630 (GRCm39) missense probably damaging 0.96
R0626:Mrc1 UTSW 2 14,333,382 (GRCm39) nonsense probably null
R1122:Mrc1 UTSW 2 14,266,147 (GRCm39) critical splice donor site probably null
R1281:Mrc1 UTSW 2 14,298,321 (GRCm39) missense probably damaging 1.00
R1399:Mrc1 UTSW 2 14,284,736 (GRCm39) missense probably damaging 1.00
R1428:Mrc1 UTSW 2 14,320,074 (GRCm39) missense probably benign 0.11
R1571:Mrc1 UTSW 2 14,313,544 (GRCm39) missense probably damaging 0.97
R1596:Mrc1 UTSW 2 14,253,701 (GRCm39) missense possibly damaging 0.91
R1730:Mrc1 UTSW 2 14,332,655 (GRCm39) missense probably benign 0.01
R1733:Mrc1 UTSW 2 14,261,910 (GRCm39) missense probably damaging 1.00
R1783:Mrc1 UTSW 2 14,332,655 (GRCm39) missense probably benign 0.01
R1860:Mrc1 UTSW 2 14,333,390 (GRCm39) missense probably benign 0.30
R1872:Mrc1 UTSW 2 14,330,192 (GRCm39) splice site probably null
R1889:Mrc1 UTSW 2 14,313,488 (GRCm39) critical splice acceptor site probably null
R1938:Mrc1 UTSW 2 14,324,052 (GRCm39) missense possibly damaging 0.89
R1971:Mrc1 UTSW 2 14,249,103 (GRCm39) critical splice donor site probably null
R2031:Mrc1 UTSW 2 14,326,584 (GRCm39) missense probably damaging 1.00
R2136:Mrc1 UTSW 2 14,275,000 (GRCm39) missense probably damaging 1.00
R2152:Mrc1 UTSW 2 14,332,675 (GRCm39) missense probably damaging 1.00
R2168:Mrc1 UTSW 2 14,249,015 (GRCm39) missense possibly damaging 0.90
R2273:Mrc1 UTSW 2 14,330,183 (GRCm39) missense probably damaging 1.00
R2901:Mrc1 UTSW 2 14,333,354 (GRCm39) missense possibly damaging 0.94
R3767:Mrc1 UTSW 2 14,323,981 (GRCm39) missense probably damaging 1.00
R3795:Mrc1 UTSW 2 14,293,793 (GRCm39) splice site probably benign
R4028:Mrc1 UTSW 2 14,243,059 (GRCm39) missense probably damaging 1.00
R4668:Mrc1 UTSW 2 14,298,297 (GRCm39) missense probably damaging 1.00
R4828:Mrc1 UTSW 2 14,275,017 (GRCm39) missense probably damaging 1.00
R4897:Mrc1 UTSW 2 14,323,952 (GRCm39) missense probably benign 0.01
R4950:Mrc1 UTSW 2 14,276,091 (GRCm39) missense probably damaging 1.00
R5000:Mrc1 UTSW 2 14,249,000 (GRCm39) missense probably damaging 1.00
R5068:Mrc1 UTSW 2 14,311,327 (GRCm39) missense probably benign 0.00
R5279:Mrc1 UTSW 2 14,314,869 (GRCm39) missense probably damaging 0.99
R5366:Mrc1 UTSW 2 14,326,725 (GRCm39) missense probably benign 0.03
R5436:Mrc1 UTSW 2 14,271,326 (GRCm39) missense probably damaging 1.00
R5631:Mrc1 UTSW 2 14,333,383 (GRCm39) nonsense probably null
R5831:Mrc1 UTSW 2 14,313,523 (GRCm39) missense probably damaging 0.99
R5978:Mrc1 UTSW 2 14,320,204 (GRCm39) missense probably damaging 0.97
R5993:Mrc1 UTSW 2 14,310,138 (GRCm39) missense probably damaging 1.00
R6030:Mrc1 UTSW 2 14,321,712 (GRCm39) missense probably benign 0.04
R6030:Mrc1 UTSW 2 14,321,712 (GRCm39) missense probably benign 0.04
R6038:Mrc1 UTSW 2 14,261,882 (GRCm39) missense probably damaging 1.00
R6038:Mrc1 UTSW 2 14,261,882 (GRCm39) missense probably damaging 1.00
R6228:Mrc1 UTSW 2 14,276,115 (GRCm39) missense probably benign 0.08
R6344:Mrc1 UTSW 2 14,248,985 (GRCm39) missense probably damaging 1.00
R6457:Mrc1 UTSW 2 14,275,016 (GRCm39) missense probably damaging 1.00
R6520:Mrc1 UTSW 2 14,312,760 (GRCm39) missense probably damaging 1.00
R6619:Mrc1 UTSW 2 14,299,597 (GRCm39) splice site probably null
R6631:Mrc1 UTSW 2 14,243,296 (GRCm39) missense probably benign
R6737:Mrc1 UTSW 2 14,276,088 (GRCm39) missense possibly damaging 0.95
R6782:Mrc1 UTSW 2 14,266,148 (GRCm39) critical splice donor site probably null
R6887:Mrc1 UTSW 2 14,330,048 (GRCm39) missense possibly damaging 0.94
R7108:Mrc1 UTSW 2 14,308,957 (GRCm39) nonsense probably null
R7120:Mrc1 UTSW 2 14,313,508 (GRCm39) missense probably damaging 0.97
R7460:Mrc1 UTSW 2 14,253,680 (GRCm39) missense probably damaging 1.00
R7567:Mrc1 UTSW 2 14,330,104 (GRCm39) missense probably damaging 1.00
R7606:Mrc1 UTSW 2 14,242,955 (GRCm39) missense probably damaging 1.00
R7725:Mrc1 UTSW 2 14,284,788 (GRCm39) missense probably benign 0.03
R7826:Mrc1 UTSW 2 14,299,668 (GRCm39) missense probably damaging 1.00
R8082:Mrc1 UTSW 2 14,253,771 (GRCm39) missense probably benign
R8279:Mrc1 UTSW 2 14,271,168 (GRCm39) missense possibly damaging 0.89
R8888:Mrc1 UTSW 2 14,312,760 (GRCm39) missense probably damaging 1.00
R8895:Mrc1 UTSW 2 14,312,760 (GRCm39) missense probably damaging 1.00
R8952:Mrc1 UTSW 2 14,253,735 (GRCm39) missense probably damaging 0.98
R9315:Mrc1 UTSW 2 14,248,969 (GRCm39) nonsense probably null
R9366:Mrc1 UTSW 2 14,321,709 (GRCm39) missense probably damaging 0.99
R9373:Mrc1 UTSW 2 14,274,999 (GRCm39) missense probably damaging 0.99
R9418:Mrc1 UTSW 2 14,234,358 (GRCm39) missense probably benign 0.12
R9420:Mrc1 UTSW 2 14,312,790 (GRCm39) missense possibly damaging 0.53
R9489:Mrc1 UTSW 2 14,324,110 (GRCm39) missense probably benign 0.06
R9564:Mrc1 UTSW 2 14,266,117 (GRCm39) missense probably benign 0.00
R9572:Mrc1 UTSW 2 14,234,334 (GRCm39) missense probably benign
R9605:Mrc1 UTSW 2 14,324,110 (GRCm39) missense probably benign 0.06
R9606:Mrc1 UTSW 2 14,313,517 (GRCm39) missense probably benign 0.01
R9781:Mrc1 UTSW 2 14,310,175 (GRCm39) missense possibly damaging 0.90
R9781:Mrc1 UTSW 2 14,249,100 (GRCm39) missense probably benign
Z1177:Mrc1 UTSW 2 14,293,927 (GRCm39) missense probably damaging 1.00
Z1177:Mrc1 UTSW 2 14,248,949 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACAATATCTCGGGTATAAAACTGA -3'
(R):5'- CCCCAGAATACTGAAAGCTGGATG -3'

Sequencing Primer
(F):5'- CCTGACTAGTTTGGTTGGAT -3'
(R):5'- TACTGAAAGCTGGATGGGAGG -3'
Posted On 2016-10-24