Incidental Mutation 'R5552:Epha8'
ID435167
Institutional Source Beutler Lab
Gene Symbol Epha8
Ensembl Gene ENSMUSG00000028661
Gene NameEph receptor A8
SynonymsEphA8, Hek3, Eek
MMRRC Submission 043109-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5552 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136929419-136956816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136931899 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 843 (N843S)
Ref Sequence ENSEMBL: ENSMUSP00000030420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030420]
Predicted Effect probably damaging
Transcript: ENSMUST00000030420
AA Change: N843S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: N843S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 30 203 2.59e-116 SMART
FN3 328 418 4.03e-6 SMART
FN3 439 520 1.67e-12 SMART
Pfam:EphA2_TM 542 631 5.8e-10 PFAM
TyrKc 634 891 1.03e-125 SMART
SAM 926 993 4.74e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,548 Y403H probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Arhgap19 T C 19: 41,784,380 I291M probably benign Het
Armc4 A G 18: 7,285,360 V267A possibly damaging Het
Blzf1 A T 1: 164,302,489 I91N probably damaging Het
Cdh2 T C 18: 16,640,463 T270A possibly damaging Het
Chd5 T A 4: 152,385,815 M1906K possibly damaging Het
Cpsf1 T C 15: 76,599,646 D799G probably benign Het
Csnk1g3 T C 18: 53,932,283 F313L probably benign Het
Cyfip1 T C 7: 55,872,107 V53A possibly damaging Het
Dcst1 T C 3: 89,365,066 D30G probably benign Het
Dlgap2 G T 8: 14,831,342 G805* probably null Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Evi5 A T 5: 107,818,989 V222E probably damaging Het
Gli1 C A 10: 127,330,262 A1041S probably benign Het
Glipr1l1 A T 10: 112,062,338 Q116L probably benign Het
Gm10436 T A 12: 88,178,365 T64S probably benign Het
Hectd4 T A 5: 121,342,851 L2985Q possibly damaging Het
Hist1h3d A G 13: 23,576,121 D107G probably damaging Het
Hk2 G T 6: 82,730,823 R694S possibly damaging Het
Htt A G 5: 34,821,774 M834V probably benign Het
Itpr2 A G 6: 146,294,080 Y1600H probably benign Het
Med1 A T 11: 98,166,331 Y340* probably null Het
Mov10l1 T A 15: 89,054,366 probably null Het
Mrc1 T C 2: 14,279,957 F586L probably benign Het
Mrrf T A 2: 36,147,961 D81E possibly damaging Het
Nod1 A G 6: 54,944,631 F234S probably damaging Het
Olfr1331 T A 4: 118,869,468 I228N probably damaging Het
Olfr822 T C 10: 130,075,145 V245A probably damaging Het
Pde4a T C 9: 21,201,386 V343A probably damaging Het
Pmfbp1 T A 8: 109,531,751 L649Q probably damaging Het
Polq A G 16: 37,094,510 I2511V possibly damaging Het
Serac1 T A 17: 6,056,692 R361* probably null Het
Serpina3g T C 12: 104,240,336 V132A probably damaging Het
Thada A C 17: 84,429,130 S908A probably benign Het
Zfp280b C T 10: 76,039,663 Q459* probably null Het
Other mutations in Epha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Epha8 APN 4 136945810 missense probably damaging 1.00
IGL00960:Epha8 APN 4 136951839 splice site probably null
IGL01124:Epha8 APN 4 136936083 missense probably damaging 1.00
IGL01550:Epha8 APN 4 136931740 missense possibly damaging 0.87
IGL01807:Epha8 APN 4 136931682 missense probably benign 0.08
IGL01844:Epha8 APN 4 136931049 makesense probably null
IGL02167:Epha8 APN 4 136931094 missense probably damaging 1.00
R0255:Epha8 UTSW 4 136940286 missense probably damaging 0.99
R0445:Epha8 UTSW 4 136932400 missense probably damaging 1.00
R1757:Epha8 UTSW 4 136931478 splice site probably null
R1911:Epha8 UTSW 4 136936314 missense probably damaging 1.00
R1936:Epha8 UTSW 4 136940243 missense probably benign 0.08
R2291:Epha8 UTSW 4 136933347 missense probably damaging 1.00
R2359:Epha8 UTSW 4 136946032 missense probably damaging 1.00
R2372:Epha8 UTSW 4 136933010 missense probably damaging 1.00
R4581:Epha8 UTSW 4 136933464 missense probably damaging 1.00
R4747:Epha8 UTSW 4 136938695 frame shift probably null
R4784:Epha8 UTSW 4 136933322 missense probably damaging 1.00
R5156:Epha8 UTSW 4 136938726 missense probably benign 0.14
R5164:Epha8 UTSW 4 136945672 missense possibly damaging 0.93
R5335:Epha8 UTSW 4 136931935 missense probably damaging 1.00
R5480:Epha8 UTSW 4 136935130 missense probably benign
R5830:Epha8 UTSW 4 136936390 nonsense probably null
R6017:Epha8 UTSW 4 136931743 missense probably damaging 1.00
R6450:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6798:Epha8 UTSW 4 136945669 missense probably benign 0.00
R6799:Epha8 UTSW 4 136945669 missense probably benign 0.00
R7060:Epha8 UTSW 4 136931158 missense probably damaging 1.00
R7297:Epha8 UTSW 4 136945913 missense probably damaging 1.00
R7344:Epha8 UTSW 4 136934538 missense probably benign 0.14
R7467:Epha8 UTSW 4 136931088 missense possibly damaging 0.90
R7563:Epha8 UTSW 4 136938789 missense possibly damaging 0.77
R7826:Epha8 UTSW 4 136936187 missense probably benign 0.09
R7845:Epha8 UTSW 4 136936401 missense probably benign 0.04
R7863:Epha8 UTSW 4 136933655 missense probably damaging 1.00
R7904:Epha8 UTSW 4 136931739 missense possibly damaging 0.95
R7918:Epha8 UTSW 4 136934566 missense probably benign 0.12
R8177:Epha8 UTSW 4 136945663 missense probably benign 0.00
R8244:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8266:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8268:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8269:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8289:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8290:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8294:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8295:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8299:Epha8 UTSW 4 136938586 missense probably damaging 0.98
RF025:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
RF054:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
Z1176:Epha8 UTSW 4 136938696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAGAACGCTCACGACATG -3'
(R):5'- CCTCTAGAACGTGTGCTCTTGG -3'

Sequencing Primer
(F):5'- TTGTGCCAGCAGTCCAG -3'
(R):5'- TGGGACAAGGCCAGCTAGC -3'
Posted On2016-10-24