Incidental Mutation 'R5552:Glipr1l1'
ID435185
Institutional Source Beutler Lab
Gene Symbol Glipr1l1
Ensembl Gene ENSMUSG00000020213
Gene NameGLI pathogenesis-related 1 like 1
Synonyms1700011E04Rik
MMRRC Submission 043109-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5552 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location112060189-112078510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112062338 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 116 (Q116L)
Ref Sequence ENSEMBL: ENSMUSP00000073302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073617]
Predicted Effect probably benign
Transcript: ENSMUST00000073617
AA Change: Q116L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000073302
Gene: ENSMUSG00000020213
AA Change: Q116L

DomainStartEndE-ValueType
SCP 40 186 6.52e-50 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,548 Y403H probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Arhgap19 T C 19: 41,784,380 I291M probably benign Het
Armc4 A G 18: 7,285,360 V267A possibly damaging Het
Blzf1 A T 1: 164,302,489 I91N probably damaging Het
Cdh2 T C 18: 16,640,463 T270A possibly damaging Het
Chd5 T A 4: 152,385,815 M1906K possibly damaging Het
Cpsf1 T C 15: 76,599,646 D799G probably benign Het
Csnk1g3 T C 18: 53,932,283 F313L probably benign Het
Cyfip1 T C 7: 55,872,107 V53A possibly damaging Het
Dcst1 T C 3: 89,365,066 D30G probably benign Het
Dlgap2 G T 8: 14,831,342 G805* probably null Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Epha8 T C 4: 136,931,899 N843S probably damaging Het
Evi5 A T 5: 107,818,989 V222E probably damaging Het
Gli1 C A 10: 127,330,262 A1041S probably benign Het
Gm10436 T A 12: 88,178,365 T64S probably benign Het
Hectd4 T A 5: 121,342,851 L2985Q possibly damaging Het
Hist1h3d A G 13: 23,576,121 D107G probably damaging Het
Hk2 G T 6: 82,730,823 R694S possibly damaging Het
Htt A G 5: 34,821,774 M834V probably benign Het
Itpr2 A G 6: 146,294,080 Y1600H probably benign Het
Med1 A T 11: 98,166,331 Y340* probably null Het
Mov10l1 T A 15: 89,054,366 probably null Het
Mrc1 T C 2: 14,279,957 F586L probably benign Het
Mrrf T A 2: 36,147,961 D81E possibly damaging Het
Nod1 A G 6: 54,944,631 F234S probably damaging Het
Olfr1331 T A 4: 118,869,468 I228N probably damaging Het
Olfr822 T C 10: 130,075,145 V245A probably damaging Het
Pde4a T C 9: 21,201,386 V343A probably damaging Het
Pmfbp1 T A 8: 109,531,751 L649Q probably damaging Het
Polq A G 16: 37,094,510 I2511V possibly damaging Het
Serac1 T A 17: 6,056,692 R361* probably null Het
Serpina3g T C 12: 104,240,336 V132A probably damaging Het
Thada A C 17: 84,429,130 S908A probably benign Het
Zfp280b C T 10: 76,039,663 Q459* probably null Het
Other mutations in Glipr1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Glipr1l1 APN 10 112078381 missense probably benign 0.02
IGL01660:Glipr1l1 APN 10 112072279 missense probably damaging 0.97
IGL01893:Glipr1l1 APN 10 112076169 missense probably benign 0.06
IGL02576:Glipr1l1 APN 10 112060319 missense possibly damaging 0.77
IGL03309:Glipr1l1 APN 10 112072236 splice site probably benign
P0031:Glipr1l1 UTSW 10 112060387 missense probably benign
R0987:Glipr1l1 UTSW 10 112078435 missense probably benign
R0992:Glipr1l1 UTSW 10 112062325 missense probably benign
R2136:Glipr1l1 UTSW 10 112060476 missense probably damaging 1.00
R2248:Glipr1l1 UTSW 10 112062287 missense probably benign 0.09
R4297:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4298:Glipr1l1 UTSW 10 112062347 missense probably benign 0.05
R4569:Glipr1l1 UTSW 10 112062412 missense probably benign 0.00
R5015:Glipr1l1 UTSW 10 112078374 missense probably benign 0.00
R5629:Glipr1l1 UTSW 10 112078403 missense possibly damaging 0.90
R6061:Glipr1l1 UTSW 10 112076170 missense probably benign 0.32
R6237:Glipr1l1 UTSW 10 112060427 nonsense probably null
R6519:Glipr1l1 UTSW 10 112062248 missense probably benign 0.02
R6913:Glipr1l1 UTSW 10 112062434 critical splice donor site probably null
R7621:Glipr1l1 UTSW 10 112060395 missense probably benign 0.00
R8171:Glipr1l1 UTSW 10 112078384 missense probably benign 0.01
X0023:Glipr1l1 UTSW 10 112078439 missense probably damaging 0.98
Z1177:Glipr1l1 UTSW 10 112078390 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAGTAACCATGCCTGTCC -3'
(R):5'- TGGAATCCCCATTAAGAGGAGG -3'

Sequencing Primer
(F):5'- ATGCCTGTCCCCTCTGAAATGG -3'
(R):5'- CTTGCCAAGTACATACCTG -3'
Posted On2016-10-24