Incidental Mutation 'R5552:Med1'
ID435188
Institutional Source Beutler Lab
Gene Symbol Med1
Ensembl Gene ENSMUSG00000018160
Gene Namemediator complex subunit 1
SynonymsPparbp, l11Jus15, PBP, TRAP 220, CRSP210, DRIP205, TRAP220
MMRRC Submission 043109-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5552 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98152154-98193293 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 98166331 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 340 (Y340*)
Ref Sequence ENSEMBL: ENSMUSP00000103169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018304] [ENSMUST00000092735] [ENSMUST00000107545]
Predicted Effect probably null
Transcript: ENSMUST00000018304
AA Change: Y325*
SMART Domains Protein: ENSMUSP00000018304
Gene: ENSMUSG00000018160
AA Change: Y325*

DomainStartEndE-ValueType
Pfam:Med1 18 414 3.7e-112 PFAM
low complexity region 536 559 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 667 678 N/A INTRINSIC
low complexity region 960 981 N/A INTRINSIC
low complexity region 989 999 N/A INTRINSIC
low complexity region 1015 1036 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1063 1138 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1205 1243 N/A INTRINSIC
low complexity region 1250 1281 N/A INTRINSIC
low complexity region 1344 1364 N/A INTRINSIC
low complexity region 1482 1503 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092735
AA Change: Y340*
SMART Domains Protein: ENSMUSP00000090411
Gene: ENSMUSG00000018160
AA Change: Y340*

DomainStartEndE-ValueType
Pfam:Med1 33 429 1.2e-113 PFAM
transmembrane domain 585 607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107545
AA Change: Y340*
SMART Domains Protein: ENSMUSP00000103169
Gene: ENSMUSG00000018160
AA Change: Y340*

DomainStartEndE-ValueType
Pfam:Med1 59 426 2.9e-74 PFAM
low complexity region 551 574 N/A INTRINSIC
low complexity region 610 634 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 975 996 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
low complexity region 1030 1051 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1078 1153 N/A INTRINSIC
low complexity region 1185 1198 N/A INTRINSIC
low complexity region 1220 1258 N/A INTRINSIC
low complexity region 1265 1296 N/A INTRINSIC
low complexity region 1359 1379 N/A INTRINSIC
low complexity region 1497 1518 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135479
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. It also regulates p53-dependent apoptosis and it is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects of placental vasculature, heart, and lens, arrested erythrocytic differentiation, impaired neuronal development, and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,548 Y403H probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Arhgap19 T C 19: 41,784,380 I291M probably benign Het
Armc4 A G 18: 7,285,360 V267A possibly damaging Het
Blzf1 A T 1: 164,302,489 I91N probably damaging Het
Cdh2 T C 18: 16,640,463 T270A possibly damaging Het
Chd5 T A 4: 152,385,815 M1906K possibly damaging Het
Cpsf1 T C 15: 76,599,646 D799G probably benign Het
Csnk1g3 T C 18: 53,932,283 F313L probably benign Het
Cyfip1 T C 7: 55,872,107 V53A possibly damaging Het
Dcst1 T C 3: 89,365,066 D30G probably benign Het
Dlgap2 G T 8: 14,831,342 G805* probably null Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Epha8 T C 4: 136,931,899 N843S probably damaging Het
Evi5 A T 5: 107,818,989 V222E probably damaging Het
Gli1 C A 10: 127,330,262 A1041S probably benign Het
Glipr1l1 A T 10: 112,062,338 Q116L probably benign Het
Gm10436 T A 12: 88,178,365 T64S probably benign Het
Hectd4 T A 5: 121,342,851 L2985Q possibly damaging Het
Hist1h3d A G 13: 23,576,121 D107G probably damaging Het
Hk2 G T 6: 82,730,823 R694S possibly damaging Het
Htt A G 5: 34,821,774 M834V probably benign Het
Itpr2 A G 6: 146,294,080 Y1600H probably benign Het
Mov10l1 T A 15: 89,054,366 probably null Het
Mrc1 T C 2: 14,279,957 F586L probably benign Het
Mrrf T A 2: 36,147,961 D81E possibly damaging Het
Nod1 A G 6: 54,944,631 F234S probably damaging Het
Olfr1331 T A 4: 118,869,468 I228N probably damaging Het
Olfr822 T C 10: 130,075,145 V245A probably damaging Het
Pde4a T C 9: 21,201,386 V343A probably damaging Het
Pmfbp1 T A 8: 109,531,751 L649Q probably damaging Het
Polq A G 16: 37,094,510 I2511V possibly damaging Het
Serac1 T A 17: 6,056,692 R361* probably null Het
Serpina3g T C 12: 104,240,336 V132A probably damaging Het
Thada A C 17: 84,429,130 S908A probably benign Het
Zfp280b C T 10: 76,039,663 Q459* probably null Het
Other mutations in Med1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Med1 APN 11 98155684 intron probably benign
IGL00690:Med1 APN 11 98169400 missense possibly damaging 0.94
IGL01087:Med1 APN 11 98180285 missense probably damaging 1.00
IGL01133:Med1 APN 11 98157986 nonsense probably null
IGL02223:Med1 APN 11 98157876 missense probably damaging 1.00
IGL02257:Med1 APN 11 98180270 missense probably damaging 0.98
IGL02699:Med1 APN 11 98180025 missense possibly damaging 0.61
IGL02706:Med1 APN 11 98156707 intron probably benign
IGL02902:Med1 APN 11 98156509 intron probably benign
IGL02986:Med1 APN 11 98156260 intron probably benign
IGL03011:Med1 APN 11 98161033 missense possibly damaging 0.92
IGL03282:Med1 APN 11 98156817 missense probably damaging 1.00
IGL03303:Med1 APN 11 98158352 missense probably damaging 1.00
IGL03342:Med1 APN 11 98189180 critical splice donor site probably null
IGL03410:Med1 APN 11 98189183 missense possibly damaging 0.62
PIT4453001:Med1 UTSW 11 98158417 missense probably benign 0.40
R0040:Med1 UTSW 11 98166255 critical splice donor site probably null
R0206:Med1 UTSW 11 98155689 intron probably benign
R0206:Med1 UTSW 11 98155689 intron probably benign
R0208:Med1 UTSW 11 98155689 intron probably benign
R0310:Med1 UTSW 11 98167574 missense probably benign 0.38
R0505:Med1 UTSW 11 98156904 missense probably damaging 1.00
R0597:Med1 UTSW 11 98169438 missense probably benign 0.08
R0680:Med1 UTSW 11 98180166 intron probably null
R0686:Med1 UTSW 11 98158404 missense probably damaging 1.00
R0698:Med1 UTSW 11 98155689 intron probably benign
R1293:Med1 UTSW 11 98157036 missense possibly damaging 0.93
R1302:Med1 UTSW 11 98157449 missense possibly damaging 0.50
R1365:Med1 UTSW 11 98155995 intron probably benign
R1537:Med1 UTSW 11 98160946 missense probably damaging 0.97
R1609:Med1 UTSW 11 98161170 missense possibly damaging 0.91
R1631:Med1 UTSW 11 98155626 intron probably benign
R1792:Med1 UTSW 11 98157283 missense probably damaging 1.00
R1831:Med1 UTSW 11 98156611 intron probably benign
R1837:Med1 UTSW 11 98169412 missense probably damaging 1.00
R2366:Med1 UTSW 11 98161182 missense probably damaging 0.98
R3754:Med1 UTSW 11 98166722 missense possibly damaging 0.77
R3762:Med1 UTSW 11 98155515 intron probably benign
R4012:Med1 UTSW 11 98171706 missense possibly damaging 0.85
R4112:Med1 UTSW 11 98180087 missense probably damaging 1.00
R4384:Med1 UTSW 11 98152862 unclassified probably benign
R4579:Med1 UTSW 11 98158422 missense possibly damaging 0.56
R4740:Med1 UTSW 11 98180264 nonsense probably null
R4819:Med1 UTSW 11 98155432 intron probably benign
R4879:Med1 UTSW 11 98155360 unclassified probably benign
R4993:Med1 UTSW 11 98163904 missense probably damaging 1.00
R5040:Med1 UTSW 11 98155404 intron probably benign
R5249:Med1 UTSW 11 98157240 missense probably benign 0.43
R5373:Med1 UTSW 11 98163963 missense probably damaging 0.99
R5374:Med1 UTSW 11 98163963 missense probably damaging 0.99
R5692:Med1 UTSW 11 98156380 intron probably benign
R6010:Med1 UTSW 11 98158362 missense probably damaging 1.00
R6149:Med1 UTSW 11 98183853 missense possibly damaging 0.74
R6417:Med1 UTSW 11 98157228 missense probably damaging 0.97
R7301:Med1 UTSW 11 98152808 missense probably benign 0.23
R7507:Med1 UTSW 11 98158026 missense probably damaging 1.00
R7529:Med1 UTSW 11 98155965 missense unknown
R7588:Med1 UTSW 11 98155572 missense unknown
R7654:Med1 UTSW 11 98169363 missense possibly damaging 0.75
R7662:Med1 UTSW 11 98155392 missense unknown
R7679:Med1 UTSW 11 98156061 missense unknown
R7862:Med1 UTSW 11 98161210 missense probably benign 0.05
R7945:Med1 UTSW 11 98161210 missense probably benign 0.05
Z1176:Med1 UTSW 11 98161183 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTGCCCAACTGAGGATGATGTAG -3'
(R):5'- AGAAGTGCTGCTGAGTACAG -3'

Sequencing Primer
(F):5'- CCCAACTGAGGATGATGTAGCAATC -3'
(R):5'- CTGAGTACAGCTTTTAGGAAAGTAC -3'
Posted On2016-10-24