Incidental Mutation 'R5552:Thada'
ID435196
Institutional Source Beutler Lab
Gene Symbol Thada
Ensembl Gene ENSMUSG00000024251
Gene Namethyroid adenoma associated
Synonyms
MMRRC Submission 043109-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5552 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location84190056-84466196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 84429130 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 908 (S908A)
Ref Sequence ENSEMBL: ENSMUSP00000041701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524]
Predicted Effect probably benign
Transcript: ENSMUST00000047524
AA Change: S908A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251
AA Change: S908A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the target of 2p21 choromosomal aberrations in benign thyroid adenomas. Single nucleotide polymorphisms (SNPs) in this gene may be associated with type 2 diabetes and polycystic ovary syndrome. The encoded protein is likely involved in the death receptor pathway and apoptosis. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,548 Y403H probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Arhgap19 T C 19: 41,784,380 I291M probably benign Het
Armc4 A G 18: 7,285,360 V267A possibly damaging Het
Blzf1 A T 1: 164,302,489 I91N probably damaging Het
Cdh2 T C 18: 16,640,463 T270A possibly damaging Het
Chd5 T A 4: 152,385,815 M1906K possibly damaging Het
Cpsf1 T C 15: 76,599,646 D799G probably benign Het
Csnk1g3 T C 18: 53,932,283 F313L probably benign Het
Cyfip1 T C 7: 55,872,107 V53A possibly damaging Het
Dcst1 T C 3: 89,365,066 D30G probably benign Het
Dlgap2 G T 8: 14,831,342 G805* probably null Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Epha8 T C 4: 136,931,899 N843S probably damaging Het
Evi5 A T 5: 107,818,989 V222E probably damaging Het
Gli1 C A 10: 127,330,262 A1041S probably benign Het
Glipr1l1 A T 10: 112,062,338 Q116L probably benign Het
Gm10436 T A 12: 88,178,365 T64S probably benign Het
Hectd4 T A 5: 121,342,851 L2985Q possibly damaging Het
Hist1h3d A G 13: 23,576,121 D107G probably damaging Het
Hk2 G T 6: 82,730,823 R694S possibly damaging Het
Htt A G 5: 34,821,774 M834V probably benign Het
Itpr2 A G 6: 146,294,080 Y1600H probably benign Het
Med1 A T 11: 98,166,331 Y340* probably null Het
Mov10l1 T A 15: 89,054,366 probably null Het
Mrc1 T C 2: 14,279,957 F586L probably benign Het
Mrrf T A 2: 36,147,961 D81E possibly damaging Het
Nod1 A G 6: 54,944,631 F234S probably damaging Het
Olfr1331 T A 4: 118,869,468 I228N probably damaging Het
Olfr822 T C 10: 130,075,145 V245A probably damaging Het
Pde4a T C 9: 21,201,386 V343A probably damaging Het
Pmfbp1 T A 8: 109,531,751 L649Q probably damaging Het
Polq A G 16: 37,094,510 I2511V possibly damaging Het
Serac1 T A 17: 6,056,692 R361* probably null Het
Serpina3g T C 12: 104,240,336 V132A probably damaging Het
Zfp280b C T 10: 76,039,663 Q459* probably null Het
Other mutations in Thada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Thada APN 17 84444218 missense probably benign 0.01
IGL00902:Thada APN 17 84447976 missense probably damaging 1.00
IGL01634:Thada APN 17 84393358 critical splice donor site probably null
IGL01689:Thada APN 17 84446688 missense possibly damaging 0.80
IGL01693:Thada APN 17 84446644 missense probably benign
IGL01937:Thada APN 17 84222766 missense probably benign 0.00
IGL01945:Thada APN 17 84222766 missense probably benign 0.00
IGL02231:Thada APN 17 84428697 missense probably damaging 1.00
IGL02951:Thada APN 17 84444028 missense probably benign 0.16
IGL03167:Thada APN 17 84458849 missense probably damaging 0.97
IGL03279:Thada APN 17 84435560 missense probably benign 0.01
IGL03347:Thada APN 17 84398205 missense probably damaging 1.00
H8562:Thada UTSW 17 84446544 missense probably damaging 1.00
IGL03098:Thada UTSW 17 84334141 missense possibly damaging 0.93
R0006:Thada UTSW 17 84226040 missense probably benign 0.00
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0357:Thada UTSW 17 84230936 missense probably damaging 1.00
R0388:Thada UTSW 17 84231096 missense probably benign 0.00
R0543:Thada UTSW 17 84423163 missense probably damaging 1.00
R0606:Thada UTSW 17 84416303 missense possibly damaging 0.90
R0630:Thada UTSW 17 84229175 missense probably damaging 1.00
R0664:Thada UTSW 17 84336829 missense probably damaging 1.00
R0855:Thada UTSW 17 84436655 missense probably damaging 1.00
R0972:Thada UTSW 17 84429062 splice site probably benign
R1297:Thada UTSW 17 84252435 splice site probably benign
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1490:Thada UTSW 17 84446601 missense possibly damaging 0.68
R1789:Thada UTSW 17 84448033 missense probably damaging 1.00
R1789:Thada UTSW 17 84448034 missense probably damaging 1.00
R1802:Thada UTSW 17 84464407 missense probably benign 0.34
R1831:Thada UTSW 17 84231114 missense probably damaging 0.97
R1834:Thada UTSW 17 84226004 missense possibly damaging 0.53
R1881:Thada UTSW 17 84436702 missense probably benign 0.19
R1925:Thada UTSW 17 84444499 missense probably benign 0.05
R1969:Thada UTSW 17 84310042 missense probably damaging 1.00
R1970:Thada UTSW 17 84310042 missense probably damaging 1.00
R1971:Thada UTSW 17 84310042 missense probably damaging 1.00
R2149:Thada UTSW 17 84441764 missense probably damaging 1.00
R2191:Thada UTSW 17 84446521 missense probably benign 0.00
R2571:Thada UTSW 17 84454640 missense probably damaging 0.99
R3405:Thada UTSW 17 84230785 splice site probably benign
R3406:Thada UTSW 17 84230785 splice site probably benign
R3916:Thada UTSW 17 84441782 missense possibly damaging 0.92
R4044:Thada UTSW 17 84441707 missense probably benign 0.41
R4461:Thada UTSW 17 84426237 missense probably damaging 1.00
R4662:Thada UTSW 17 84435650 missense probably damaging 1.00
R4696:Thada UTSW 17 84426186 missense possibly damaging 0.83
R4786:Thada UTSW 17 84458855 missense possibly damaging 0.66
R4803:Thada UTSW 17 84272817 missense probably damaging 0.96
R4835:Thada UTSW 17 84441104 splice site probably null
R4872:Thada UTSW 17 84446599 missense probably damaging 1.00
R4898:Thada UTSW 17 84448042 splice site probably null
R4903:Thada UTSW 17 84252400 missense possibly damaging 0.67
R4929:Thada UTSW 17 84444226 missense probably benign 0.01
R4959:Thada UTSW 17 84444183 missense probably damaging 1.00
R5071:Thada UTSW 17 84386532 missense probably damaging 1.00
R5092:Thada UTSW 17 84444468 missense probably damaging 0.97
R5398:Thada UTSW 17 84426186 missense probably benign 0.03
R5480:Thada UTSW 17 84432254 missense probably benign 0.00
R5575:Thada UTSW 17 84416399 splice site probably null
R5623:Thada UTSW 17 84191983 missense probably benign 0.00
R5688:Thada UTSW 17 84451727 missense probably benign 0.00
R5704:Thada UTSW 17 84230901 missense probably benign 0.01
R6008:Thada UTSW 17 84436634 missense probably damaging 1.00
R6013:Thada UTSW 17 84272800 missense probably benign 0.00
R6072:Thada UTSW 17 84192006 missense possibly damaging 0.93
R6156:Thada UTSW 17 84393367 missense probably damaging 0.98
R6243:Thada UTSW 17 84436602 missense probably benign 0.01
R6449:Thada UTSW 17 84429173 missense probably benign
R6453:Thada UTSW 17 84416323 missense probably damaging 1.00
R6474:Thada UTSW 17 84443911 missense possibly damaging 0.83
R6732:Thada UTSW 17 84454414 intron probably null
R6907:Thada UTSW 17 84393469 missense probably damaging 1.00
R7117:Thada UTSW 17 84230786 splice site probably null
R7167:Thada UTSW 17 84230963 missense probably benign
R7221:Thada UTSW 17 84464366 missense possibly damaging 0.46
R7470:Thada UTSW 17 84226041 missense probably benign
R7753:Thada UTSW 17 84252390 missense probably damaging 1.00
R7809:Thada UTSW 17 84451837 missense possibly damaging 0.80
R7882:Thada UTSW 17 84429196 missense possibly damaging 0.85
R7965:Thada UTSW 17 84429196 missense possibly damaging 0.85
R8004:Thada UTSW 17 84192205 missense probably benign
R8153:Thada UTSW 17 84393427 missense possibly damaging 0.90
Z1176:Thada UTSW 17 84444430 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AATCTGGGGCTCAAACATGAG -3'
(R):5'- CTTTGATTCCAAACCTCTGAAACAG -3'

Sequencing Primer
(F):5'- ATCTGGGGCTCAAACATGAGTTATG -3'
(R):5'- TGACCTGAGTTGGAATCACC -3'
Posted On2016-10-24