Incidental Mutation 'R5553:Selenon'
ID 435216
Institutional Source Beutler Lab
Gene Symbol Selenon
Ensembl Gene ENSMUSG00000050989
Gene Name selenoprotein N
Synonyms Sepn1, 1110019I12Rik
MMRRC Submission 043110-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5553 (G1)
Quality Score 223
Status Not validated
Chromosome 4
Chromosomal Location 134265203-134279477 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 134268228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 435 (R435L)
Ref Sequence ENSEMBL: ENSMUSP00000060026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060435]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000060435
AA Change: R435L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060026
Gene: ENSMUSG00000050989
AA Change: R435L

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1k94a_ 76 113 4e-3 SMART
low complexity region 160 179 N/A INTRINSIC
low complexity region 526 532 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127585
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein that is localized in the endoplasmic reticulum. It plays an important role in cell protection against oxidative stress, and in the regulation of redox-related calcium homeostasis. Mutations in the orthologous gene in human are associated with early onset muscle disorders, referred to as SEPN1-related myopathy. Knockout mice deleted for this gene exhibit abnormal lung development. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A second stop-codon redefinition element (SRE) adjacent to the UGA codon has been identified in this gene (PMID:15791204). SRE is a phylogenetically conserved stem-loop structure that stimulates readthrough at the UGA codon, and augments the Sec insertion efficiency by SECIS. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit satellite cell loss and impaired muscle regeneration. Mice homozygous for a different knock-out allele exhibit subtle core lesions in skeletal muscle after induced oxidative stress and abnormal lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,792,690 (GRCm39) I86F probably damaging Het
Abca13 C T 11: 9,278,158 (GRCm39) L3113F probably damaging Het
Ankrd39 C T 1: 36,581,062 (GRCm39) G96R probably damaging Het
Ano8 T A 8: 71,937,641 (GRCm39) probably null Het
Arid1b A T 17: 5,364,152 (GRCm39) S1041C probably damaging Het
Bsn T A 9: 107,987,620 (GRCm39) probably benign Het
Cbr3 A G 16: 93,480,451 (GRCm39) E80G possibly damaging Het
Chd1 A G 17: 17,605,875 (GRCm39) E271G probably benign Het
Dock3 T A 9: 106,868,309 (GRCm39) K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,619,462 (GRCm39) probably benign Het
Dppa1 T A 11: 46,503,861 (GRCm39) probably null Het
Fen1 T C 19: 10,177,787 (GRCm39) N219S probably benign Het
Fsip2 A G 2: 82,793,090 (GRCm39) T416A probably benign Het
Gm14393 A T 2: 174,903,639 (GRCm39) C89* probably null Het
Grin2c C T 11: 115,143,551 (GRCm39) M736I probably null Het
Heatr5b A T 17: 79,060,780 (GRCm39) probably null Het
Hspbap1 G T 16: 35,621,967 (GRCm39) W104L probably damaging Het
Igfn1 C T 1: 135,895,622 (GRCm39) G1648E probably damaging Het
Irf4 A G 13: 30,935,811 (GRCm39) Y122C probably damaging Het
Kremen2 A G 17: 23,960,776 (GRCm39) probably benign Het
Niban1 C T 1: 151,592,986 (GRCm39) T557M probably damaging Het
Nubpl T A 12: 52,228,082 (GRCm39) L169M possibly damaging Het
Nwd1 T C 8: 73,431,604 (GRCm39) S1200P possibly damaging Het
Or1j20 A G 2: 36,760,477 (GRCm39) I300V probably benign Het
Or5p61 A T 7: 107,758,478 (GRCm39) S201T probably benign Het
Parp14 G T 16: 35,677,306 (GRCm39) H887Q probably benign Het
Paxip1 G A 5: 27,980,637 (GRCm39) probably benign Het
Piwil1 T C 5: 128,822,565 (GRCm39) M392T probably benign Het
Plekhm3 T C 1: 64,961,045 (GRCm39) S404G possibly damaging Het
Prelid3a T C 18: 67,610,093 (GRCm39) L141P probably damaging Het
Ptprb T A 10: 116,186,090 (GRCm39) V1715E probably damaging Het
Rc3h2 G A 2: 37,288,323 (GRCm39) R420* probably null Het
Slc29a4 T C 5: 142,705,791 (GRCm39) L425P probably damaging Het
Slc30a9 T A 5: 67,502,947 (GRCm39) probably null Het
Slc9a5 T C 8: 106,083,672 (GRCm39) V404A probably damaging Het
Ssc5d A T 7: 4,939,289 (GRCm39) D575V probably damaging Het
Ttn A C 2: 76,721,940 (GRCm39) probably null Het
Vmn2r100 A G 17: 19,725,110 (GRCm39) Q13R possibly damaging Het
Wfikkn1 T A 17: 26,097,468 (GRCm39) L285F possibly damaging Het
Zcchc17 A G 4: 130,247,927 (GRCm39) probably null Het
Other mutations in Selenon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Selenon APN 4 134,267,037 (GRCm39) unclassified probably benign
IGL02832:Selenon APN 4 134,268,219 (GRCm39) missense probably damaging 1.00
IGL03015:Selenon APN 4 134,272,829 (GRCm39) missense probably benign 0.43
G1Funyon:Selenon UTSW 4 134,278,725 (GRCm39) splice site probably benign
I0000:Selenon UTSW 4 134,270,012 (GRCm39) splice site probably benign
R1400:Selenon UTSW 4 134,278,829 (GRCm39) missense probably benign 0.00
R1436:Selenon UTSW 4 134,267,997 (GRCm39) missense probably damaging 1.00
R1932:Selenon UTSW 4 134,271,929 (GRCm39) missense probably damaging 0.99
R2886:Selenon UTSW 4 134,270,380 (GRCm39) missense probably null 1.00
R3884:Selenon UTSW 4 134,267,081 (GRCm39) missense possibly damaging 0.80
R4647:Selenon UTSW 4 134,272,968 (GRCm39) missense probably damaging 1.00
R4721:Selenon UTSW 4 134,270,387 (GRCm39) nonsense probably null
R5091:Selenon UTSW 4 134,275,284 (GRCm39) missense probably damaging 1.00
R5412:Selenon UTSW 4 134,269,749 (GRCm39) missense probably benign 0.00
R7048:Selenon UTSW 4 134,270,154 (GRCm39) missense probably benign 0.04
R7222:Selenon UTSW 4 134,275,288 (GRCm39) missense possibly damaging 0.60
R7470:Selenon UTSW 4 134,267,061 (GRCm39) missense probably benign 0.29
R8301:Selenon UTSW 4 134,278,725 (GRCm39) splice site probably benign
R8452:Selenon UTSW 4 134,275,398 (GRCm39) splice site probably null
R8753:Selenon UTSW 4 134,275,330 (GRCm39) missense probably benign 0.21
R8921:Selenon UTSW 4 134,268,153 (GRCm39) missense possibly damaging 0.92
R9570:Selenon UTSW 4 134,270,055 (GRCm39) missense probably benign 0.01
R9785:Selenon UTSW 4 134,270,374 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATACTTCCTGGTATCTGGGCC -3'
(R):5'- TGTCCATGCTGATCCTACAAC -3'

Sequencing Primer
(F):5'- TATCTGGGCCCAGTGCTGTC -3'
(R):5'- AGCCTCCTGAGTGCTAGGATAC -3'
Posted On 2016-10-24