Mutagenetix > Incidental Mutation

Incidental Mutation 'R5553:Ssc5d'

435222

Institutional Source

Beutler Lab

Gene Symbol

Ssc5d

Ensembl Gene

ENSMUSG00000035279

Gene Name

scavenger receptor cysteine rich family, 5 domains

Synonyms

s5d-srcrb, A430110N23Rik

MMRRC Submission

043110-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5553 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4925785-4944826 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 4936290 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 575 (D575V)

Ref Sequence

ENSEMBL: ENSMUSP00000052126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057612] [ENSMUST00000208109]

AlphaFold

Q8BV57

Predicted Effect

probably damaging
Transcript: ENSMUST00000057612
AA Change: D575V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052126
Gene: ENSMUSG00000035279
AA Change: D575V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SR	20	120	4.44e-49	SMART
low complexity region	141	155	N/A	INTRINSIC
low complexity region	167	182	N/A	INTRINSIC
SR	199	299	2.36e-53	SMART
SR	305	405	8.22e-53	SMART
low complexity region	437	462	N/A	INTRINSIC
SR	464	565	1.11e-49	SMART
low complexity region	741	755	N/A	INTRINSIC
SR	758	858	3.93e-50	SMART
low complexity region	936	957	N/A	INTRINSIC
low complexity region	981	1004	N/A	INTRINSIC
low complexity region	1018	1035	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1357	1364	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207310

Predicted Effect

probably benign
Transcript: ENSMUST00000208109

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	A	15: 60,920,841	I86F	probably damaging	Het
Abca13	C	T	11: 9,328,158	L3113F	probably damaging	Het
Ankrd39	C	T	1: 36,541,981	G96R	probably damaging	Het
Ano8	T	A	8: 71,484,997		probably null	Het
Arid1b	A	T	17: 5,313,877	S1041C	probably damaging	Het
Bsn	T	A	9: 108,110,421		probably benign	Het
Cbr3	A	G	16: 93,683,563	E80G	possibly damaging	Het
Chd1	A	G	17: 17,385,613	E271G	probably benign	Het
Dock3	T	A	9: 106,991,110	K658N	possibly damaging	Het
Dot1l	CCAGCCCCACCCTCAGCC	CCAGCC	10: 80,783,628		probably benign	Het
Dppa1	T	A	11: 46,613,034		probably null	Het
Fam129a	C	T	1: 151,717,235	T557M	probably damaging	Het
Fen1	T	C	19: 10,200,423	N219S	probably benign	Het
Fsip2	A	G	2: 82,962,746	T416A	probably benign	Het
Gm14393	A	T	2: 175,061,846	C89*	probably null	Het
Grin2c	C	T	11: 115,252,725	M736I	probably null	Het
Heatr5b	A	T	17: 78,753,351		probably null	Het
Hspbap1	G	T	16: 35,801,597	W104L	probably damaging	Het
Igfn1	C	T	1: 135,967,884	G1648E	probably damaging	Het
Irf4	A	G	13: 30,751,828	Y122C	probably damaging	Het
Kremen2	A	G	17: 23,741,802		probably benign	Het
Nubpl	T	A	12: 52,181,299	L169M	possibly damaging	Het
Nwd1	T	C	8: 72,704,976	S1200P	possibly damaging	Het
Olfr352	A	G	2: 36,870,465	I300V	probably benign	Het
Olfr485	A	T	7: 108,159,271	S201T	probably benign	Het
Parp14	G	T	16: 35,856,936	H887Q	probably benign	Het
Paxip1	G	A	5: 27,775,639		probably benign	Het
Piwil1	T	C	5: 128,745,501	M392T	probably benign	Het
Plekhm3	T	C	1: 64,921,886	S404G	possibly damaging	Het
Prelid3a	T	C	18: 67,477,023	L141P	probably damaging	Het
Ptprb	T	A	10: 116,350,185	V1715E	probably damaging	Het
Rc3h2	G	A	2: 37,398,311	R420*	probably null	Het
Selenon	C	A	4: 134,540,917	R435L	probably damaging	Het
Slc29a4	T	C	5: 142,720,036	L425P	probably damaging	Het
Slc30a9	T	A	5: 67,345,604		probably null	Het
Slc9a5	T	C	8: 105,357,040	V404A	probably damaging	Het
Ttn	A	C	2: 76,891,596		probably null	Het
Vmn2r100	A	G	17: 19,504,848	Q13R	possibly damaging	Het
Wfikkn1	T	A	17: 25,878,494	L285F	possibly damaging	Het
Zcchc17	A	G	4: 130,354,134		probably null	Het

Other mutations in Ssc5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Ssc5d	APN	7	4944481	missense	possibly damaging	0.63
IGL00939:Ssc5d	APN	7	4936281	missense	possibly damaging	0.89
IGL01109:Ssc5d	APN	7	4937112	nonsense	probably null
IGL01409:Ssc5d	APN	7	4942809	missense	probably benign	0.16
IGL01880:Ssc5d	APN	7	4933219	missense	probably damaging	1.00
IGL02013:Ssc5d	APN	7	4943836	missense	probably benign	0.00
IGL02227:Ssc5d	APN	7	4933454	critical splice donor site	probably null
IGL02963:Ssc5d	APN	7	4944327	missense	probably benign	0.02
D4043:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
D4216:Ssc5d	UTSW	7	4943983	missense	possibly damaging	0.70
R0104:Ssc5d	UTSW	7	4936286	missense	probably benign	0.41
R0115:Ssc5d	UTSW	7	4927881	unclassified	probably benign
R0201:Ssc5d	UTSW	7	4944663	missense	probably benign
R0365:Ssc5d	UTSW	7	4928467	nonsense	probably null
R0485:Ssc5d	UTSW	7	4937471	missense	probably damaging	0.99
R0967:Ssc5d	UTSW	7	4944343	nonsense	probably null
R1607:Ssc5d	UTSW	7	4944043	missense	probably benign	0.25
R1639:Ssc5d	UTSW	7	4928417	missense	probably damaging	1.00
R1801:Ssc5d	UTSW	7	4936607	missense	probably benign	0.05
R1867:Ssc5d	UTSW	7	4928507	missense	probably damaging	1.00
R1999:Ssc5d	UTSW	7	4942714	missense	possibly damaging	0.86
R2007:Ssc5d	UTSW	7	4928629	missense	probably damaging	1.00
R2084:Ssc5d	UTSW	7	4937012	missense	probably benign	0.01
R2234:Ssc5d	UTSW	7	4943850	missense	probably benign
R2259:Ssc5d	UTSW	7	4943916	missense	probably benign	0.01
R2567:Ssc5d	UTSW	7	4936335	missense	probably damaging	1.00
R2879:Ssc5d	UTSW	7	4936907	critical splice acceptor site	probably null
R3782:Ssc5d	UTSW	7	4942791	missense	probably benign	0.00
R3875:Ssc5d	UTSW	7	4927262	missense	probably damaging	1.00
R4322:Ssc5d	UTSW	7	4928450	missense	probably damaging	1.00
R4331:Ssc5d	UTSW	7	4942726	missense	probably benign	0.00
R4334:Ssc5d	UTSW	7	4943664	missense	probably benign
R4430:Ssc5d	UTSW	7	4943664	missense	probably benign
R4619:Ssc5d	UTSW	7	4929525	missense	probably damaging	1.00
R4794:Ssc5d	UTSW	7	4943745	missense	probably benign
R5106:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R5174:Ssc5d	UTSW	7	4927971	missense	possibly damaging	0.83
R5649:Ssc5d	UTSW	7	4926518	critical splice donor site	probably null
R5786:Ssc5d	UTSW	7	4936818	missense	probably benign	0.00
R6059:Ssc5d	UTSW	7	4942744	missense	possibly damaging	0.86
R6163:Ssc5d	UTSW	7	4927254	missense	probably damaging	1.00
R6332:Ssc5d	UTSW	7	4937522	missense	probably damaging	1.00
R6341:Ssc5d	UTSW	7	4936665	missense	probably benign	0.31
R6613:Ssc5d	UTSW	7	4933293	missense	possibly damaging	0.82
R7180:Ssc5d	UTSW	7	4936601	missense	probably benign	0.17
R7576:Ssc5d	UTSW	7	4928573	missense	probably damaging	1.00
R7602:Ssc5d	UTSW	7	4942746	missense	possibly damaging	0.95
R7609:Ssc5d	UTSW	7	4927576	missense	possibly damaging	0.56
R7691:Ssc5d	UTSW	7	4944169	missense	probably benign	0.29
R7759:Ssc5d	UTSW	7	4937530	nonsense	probably null
R8480:Ssc5d	UTSW	7	4936329	missense	probably damaging	1.00
R9029:Ssc5d	UTSW	7	4927920	missense	probably damaging	0.97
R9163:Ssc5d	UTSW	7	4933433	missense	probably damaging	1.00
R9178:Ssc5d	UTSW	7	4927059	missense	probably damaging	1.00
R9181:Ssc5d	UTSW	7	4942815	missense	possibly damaging	0.86
R9382:Ssc5d	UTSW	7	4927284	critical splice donor site	probably null
R9489:Ssc5d	UTSW	7	4937600	missense	probably benign	0.02
R9626:Ssc5d	UTSW	7	4943569	missense	probably benign
R9630:Ssc5d	UTSW	7	4936427	missense	probably damaging	1.00
R9776:Ssc5d	UTSW	7	4929368	missense	probably benign	0.07
X0063:Ssc5d	UTSW	7	4936287	missense	probably damaging	1.00
Z1088:Ssc5d	UTSW	7	4928434	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCACACTTAGTATAGATTGCCTT -3'
(R):5'- AGTGGTTGGTCTCCTTGCAT -3'

Sequencing Primer
(F):5'- TTCAGACCTTCGGAAGAGCAGTC -3'
(R):5'- GCATTTTTAGTCACCCACTTCTTGG -3'

Posted On

2016-10-24