Incidental Mutation 'R5553:Irf4'
ID435235
Institutional Source Beutler Lab
Gene Symbol Irf4
Ensembl Gene ENSMUSG00000021356
Gene Nameinterferon regulatory factor 4
SynonymsIRF-4, Spip
MMRRC Submission 043110-MU
Accession Numbers

Genbank: NM_013674; MGI: 1096873

Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R5553 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location30749226-30766976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30751828 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 122 (Y122C)
Ref Sequence ENSEMBL: ENSMUSP00000105936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021784] [ENSMUST00000110307] [ENSMUST00000222125]
Predicted Effect probably damaging
Transcript: ENSMUST00000021784
AA Change: Y122C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021784
Gene: ENSMUSG00000021356
AA Change: Y122C

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
IRF-3 249 418 1.17e-84 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110307
AA Change: Y122C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105936
Gene: ENSMUSG00000021356
AA Change: Y122C

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
IRF-3 248 417 1.17e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222125
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display immune system abnormalities involving development of both T and B cells and affecting susceptibility to both bacterial and viral infections as well as impaired thermogenic gene expression and energy expenditure. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,920,841 I86F probably damaging Het
Abca13 C T 11: 9,328,158 L3113F probably damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Ano8 T A 8: 71,484,997 probably null Het
Arid1b A T 17: 5,313,877 S1041C probably damaging Het
Bsn T A 9: 108,110,421 probably benign Het
Cbr3 A G 16: 93,683,563 E80G possibly damaging Het
Chd1 A G 17: 17,385,613 E271G probably benign Het
Dock3 T A 9: 106,991,110 K658N possibly damaging Het
Dot1l CCAGCCCCACCCTCAGCC CCAGCC 10: 80,783,628 probably benign Het
Dppa1 T A 11: 46,613,034 probably null Het
Fam129a C T 1: 151,717,235 T557M probably damaging Het
Fen1 T C 19: 10,200,423 N219S probably benign Het
Fsip2 A G 2: 82,962,746 T416A probably benign Het
Gm14393 A T 2: 175,061,846 C89* probably null Het
Grin2c C T 11: 115,252,725 M736I probably null Het
Heatr5b A T 17: 78,753,351 probably null Het
Hspbap1 G T 16: 35,801,597 W104L probably damaging Het
Igfn1 C T 1: 135,967,884 G1648E probably damaging Het
Kremen2 A G 17: 23,741,802 probably benign Het
Nubpl T A 12: 52,181,299 L169M possibly damaging Het
Nwd1 T C 8: 72,704,976 S1200P possibly damaging Het
Olfr352 A G 2: 36,870,465 I300V probably benign Het
Olfr485 A T 7: 108,159,271 S201T probably benign Het
Parp14 G T 16: 35,856,936 H887Q probably benign Het
Paxip1 G A 5: 27,775,639 probably benign Het
Piwil1 T C 5: 128,745,501 M392T probably benign Het
Plekhm3 T C 1: 64,921,886 S404G possibly damaging Het
Prelid3a T C 18: 67,477,023 L141P probably damaging Het
Ptprb T A 10: 116,350,185 V1715E probably damaging Het
Rc3h2 G A 2: 37,398,311 R420* probably null Het
Selenon C A 4: 134,540,917 R435L probably damaging Het
Slc29a4 T C 5: 142,720,036 L425P probably damaging Het
Slc30a9 T A 5: 67,345,604 probably null Het
Slc9a5 T C 8: 105,357,040 V404A probably damaging Het
Ssc5d A T 7: 4,936,290 D575V probably damaging Het
Ttn A C 2: 76,891,596 probably null Het
Vmn2r100 A G 17: 19,504,848 Q13R possibly damaging Het
Wfikkn1 T A 17: 25,878,494 L285F possibly damaging Het
Zcchc17 A G 4: 130,354,134 probably null Het
Other mutations in Irf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Irf4 APN 13 30751784 missense probably damaging 1.00
IGL01154:Irf4 APN 13 30757421 missense possibly damaging 0.46
IGL01669:Irf4 APN 13 30757471 missense probably damaging 0.99
IGL02729:Irf4 APN 13 30753591 critical splice donor site probably null
IGL03197:Irf4 APN 13 30763520 splice site probably benign
honey UTSW 13 30751751 missense probably damaging 0.99
Honey2 UTSW 13 30761490 splice site probably benign
miel UTSW 13 30761462 missense probably benign 0.00
R1300:Irf4 UTSW 13 30757585 missense probably damaging 0.98
R1656:Irf4 UTSW 13 30757502 missense probably benign
R1914:Irf4 UTSW 13 30761462 missense probably benign 0.00
R1915:Irf4 UTSW 13 30761462 missense probably benign 0.00
R3889:Irf4 UTSW 13 30761490 splice site probably benign
R4648:Irf4 UTSW 13 30763597 missense probably benign 0.00
R5913:Irf4 UTSW 13 30757758 missense probably benign
R7809:Irf4 UTSW 13 30757432 missense probably benign 0.07
R7894:Irf4 UTSW 13 30753452 missense probably benign
R7977:Irf4 UTSW 13 30753452 missense probably benign
R8051:Irf4 UTSW 13 30761473 missense probably damaging 0.98
Z1177:Irf4 UTSW 13 30750661 missense probably damaging 0.98
Z1177:Irf4 UTSW 13 30750663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGACGCTCTGGGCTTGAC -3'
(R):5'- TCTGCCAGGTCATCCTATACTAAC -3'

Sequencing Primer
(F):5'- GACGCTCTGGGCTTGACTTTTC -3'
(R):5'- CCACAGGGTTGTCACTTATAACAGAG -3'
Posted On2016-10-24