Mutagenetix > Incidental Mutation

Incidental Mutation 'R5553:Chd1'

435241

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

043110-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5553 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15704967-15772610 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17385613 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 271 (E271G)

Ref Sequence

ENSEMBL: ENSMUSP00000156350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024620] [ENSMUST00000232199] [ENSMUST00000232396]

AlphaFold

P40201

Predicted Effect

probably benign
Transcript: ENSMUST00000024620
AA Change: E271G

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000024620
Gene: ENSMUSG00000116564
AA Change: E271G

Domain	Start	End	E-Value	Type
Pfam:Rio2_N	9	91	9.5e-36	PFAM
Pfam:Kdo	105	193	6.3e-8	PFAM
Pfam:RIO1	108	284	1.7e-57	PFAM
Pfam:APH	194	278	3.2e-8	PFAM
low complexity region	326	340	N/A	INTRINSIC
low complexity region	501	518	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181390

Predicted Effect

probably benign
Transcript: ENSMUST00000232199
AA Change: E113G

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000232396
AA Change: E271G

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	A	15: 60,920,841	I86F	probably damaging	Het
Abca13	C	T	11: 9,328,158	L3113F	probably damaging	Het
Ankrd39	C	T	1: 36,541,981	G96R	probably damaging	Het
Ano8	T	A	8: 71,484,997		probably null	Het
Arid1b	A	T	17: 5,313,877	S1041C	probably damaging	Het
Bsn	T	A	9: 108,110,421		probably benign	Het
Cbr3	A	G	16: 93,683,563	E80G	possibly damaging	Het
Dock3	T	A	9: 106,991,110	K658N	possibly damaging	Het
Dot1l	CCAGCCCCACCCTCAGCC	CCAGCC	10: 80,783,628		probably benign	Het
Dppa1	T	A	11: 46,613,034		probably null	Het
Fam129a	C	T	1: 151,717,235	T557M	probably damaging	Het
Fen1	T	C	19: 10,200,423	N219S	probably benign	Het
Fsip2	A	G	2: 82,962,746	T416A	probably benign	Het
Gm14393	A	T	2: 175,061,846	C89*	probably null	Het
Grin2c	C	T	11: 115,252,725	M736I	probably null	Het
Heatr5b	A	T	17: 78,753,351		probably null	Het
Hspbap1	G	T	16: 35,801,597	W104L	probably damaging	Het
Igfn1	C	T	1: 135,967,884	G1648E	probably damaging	Het
Irf4	A	G	13: 30,751,828	Y122C	probably damaging	Het
Kremen2	A	G	17: 23,741,802		probably benign	Het
Nubpl	T	A	12: 52,181,299	L169M	possibly damaging	Het
Nwd1	T	C	8: 72,704,976	S1200P	possibly damaging	Het
Olfr352	A	G	2: 36,870,465	I300V	probably benign	Het
Olfr485	A	T	7: 108,159,271	S201T	probably benign	Het
Parp14	G	T	16: 35,856,936	H887Q	probably benign	Het
Paxip1	G	A	5: 27,775,639		probably benign	Het
Piwil1	T	C	5: 128,745,501	M392T	probably benign	Het
Plekhm3	T	C	1: 64,921,886	S404G	possibly damaging	Het
Prelid3a	T	C	18: 67,477,023	L141P	probably damaging	Het
Ptprb	T	A	10: 116,350,185	V1715E	probably damaging	Het
Rc3h2	G	A	2: 37,398,311	R420*	probably null	Het
Selenon	C	A	4: 134,540,917	R435L	probably damaging	Het
Slc29a4	T	C	5: 142,720,036	L425P	probably damaging	Het
Slc30a9	T	A	5: 67,345,604		probably null	Het
Slc9a5	T	C	8: 105,357,040	V404A	probably damaging	Het
Ssc5d	A	T	7: 4,936,290	D575V	probably damaging	Het
Ttn	A	C	2: 76,891,596		probably null	Het
Vmn2r100	A	G	17: 19,504,848	Q13R	possibly damaging	Het
Wfikkn1	T	A	17: 25,878,494	L285F	possibly damaging	Het
Zcchc17	A	G	4: 130,354,134		probably null	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15732565	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15749865	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15754997	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17378569	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15770097	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17378596	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15770168	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15742173	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17390053	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15734273	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15730807	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15749500	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15770298	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15725281	missense	possibly damaging	0.70
Holly	UTSW	17	15726283	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17393567	missense	probably damaging	1.00
R0197:Chd1	UTSW	17	15725431	missense	probably benign
R0285:Chd1	UTSW	17	17374680	splice site	probably benign
R0326:Chd1	UTSW	17	15768566	missense	probably damaging	1.00
R0326:Chd1	UTSW	17	15768568	missense	probably benign
R0372:Chd1	UTSW	17	17387290	missense	probably benign	0.14
R0391:Chd1	UTSW	17	15749894	missense	probably damaging	1.00
R0486:Chd1	UTSW	17	15734342	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15742288	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15758261	unclassified	probably benign
R0701:Chd1	UTSW	17	15725431	missense	probably benign
R0788:Chd1	UTSW	17	15707114	missense	possibly damaging	0.86
R0848:Chd1	UTSW	17	15770241	missense	probably damaging	1.00
R0883:Chd1	UTSW	17	15725431	missense	probably benign
R1169:Chd1	UTSW	17	15735732	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15725312	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17387480	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15739507	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15743232	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17387271	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15770303	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15762486	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15731006	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15742294	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15731871	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15770027	nonsense	probably null
R4242:Chd1	UTSW	17	15770027	nonsense	probably null
R4354:Chd1	UTSW	17	17390001	missense	probably benign	0.23
R4468:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4469:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17377817	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15733124	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15768753	nonsense	probably null
R4840:Chd1	UTSW	17	15768754	missense	probably damaging	1.00
R4880:Chd1	UTSW	17	17374654	missense	probably damaging	1.00
R4960:Chd1	UTSW	17	15742231	missense	probably damaging	0.96
R5071:Chd1	UTSW	17	15762405	missense	probably benign
R5078:Chd1	UTSW	17	15726354	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15728198	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15735743	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15754951	missense	probably benign	0.01
R5304:Chd1	UTSW	17	15770268	missense	possibly damaging	0.55
R5307:Chd1	UTSW	17	15732570	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15738549	missense	probably damaging	1.00
R5623:Chd1	UTSW	17	15754932	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17377773	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15758688	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15730203	splice site	probably null
R6373:Chd1	UTSW	17	15738636	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15730602	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17380988	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15738633	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15725430	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17387167	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15761366	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15706937	splice site	probably null
R7317:Chd1	UTSW	17	15742274	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15770237	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15749398	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15767475	missense	probably benign
R7763:Chd1	UTSW	17	15733041	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15761404	missense	probably benign
R8194:Chd1	UTSW	17	17374475	start gained	probably benign
R8261:Chd1	UTSW	17	17387542	missense	probably benign	0.02
R8338:Chd1	UTSW	17	15769980	missense	probably damaging	1.00
R8401:Chd1	UTSW	17	15743211	missense	probably damaging	1.00
R8411:Chd1	UTSW	17	15762449	missense	probably damaging	0.98
R9067:Chd1	UTSW	17	15730845	missense	possibly damaging	0.49
R9184:Chd1	UTSW	17	15742289	missense	possibly damaging	0.71
R9210:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9212:Chd1	UTSW	17	15730505	missense	possibly damaging	0.70
R9666:Chd1	UTSW	17	15735714	missense	probably damaging	1.00
R9673:Chd1	UTSW	17	15768761	missense	probably benign	0.24
Z1176:Chd1	UTSW	17	15766347	missense	probably damaging	0.98
Z1176:Chd1	UTSW	17	15768733	missense	probably damaging	1.00
Z1177:Chd1	UTSW	17	15747801	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAGCCATTTATTCAAGCAGAAC -3'
(R):5'- GGGCTATGAATATTTGATACAGCAG -3'

Sequencing Primer
(F):5'- GCCATTTATTCAAGCAGAACTTCAAG -3'
(R):5'- GTGGCTCACAAACATCTATAATGGG -3'

Posted On

2016-10-24