Incidental Mutation 'R5554:Ptpn3'
ID435272
Institutional Source Beutler Lab
Gene Symbol Ptpn3
Ensembl Gene ENSMUSG00000038764
Gene Nameprotein tyrosine phosphatase, non-receptor type 3
Synonyms9530011I20Rik, PTPCL, PTP-H1
MMRRC Submission 043111-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R5554 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location57190841-57301837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57240843 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 257 (N257K)
Ref Sequence ENSEMBL: ENSMUSP00000075063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075637] [ENSMUST00000153926]
Predicted Effect probably damaging
Transcript: ENSMUST00000075637
AA Change: N257K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075063
Gene: ENSMUSG00000038764
AA Change: N257K

DomainStartEndE-ValueType
B41 25 222 2.44e-67 SMART
FERM_C 226 316 2.64e-25 SMART
low complexity region 454 470 N/A INTRINSIC
PDZ 519 598 1.65e-15 SMART
PTPc 645 903 5.66e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153926
SMART Domains Protein: ENSMUSP00000122490
Gene: ENSMUSG00000038764

DomainStartEndE-ValueType
B41 25 222 2.44e-67 SMART
Meta Mutation Damage Score 0.1213 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, especially in males, and male mice exhibit increased bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,413,981 R227L probably benign Het
Adamtsl1 A G 4: 86,276,945 Q533R possibly damaging Het
Adgb C T 10: 10,340,473 R1524H probably damaging Het
Ank2 A T 3: 126,998,973 N739K possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Anxa10 G A 8: 62,061,046 P249L possibly damaging Het
Banp G A 8: 121,991,595 E183K probably damaging Het
BC051665 C G 13: 60,784,621 L83F probably damaging Het
Btn1a1 A T 13: 23,459,125 F385I possibly damaging Het
Chchd4 A T 6: 91,465,017 *140R probably null Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dlx2 G A 2: 71,545,461 R173C possibly damaging Het
Dmbt1 C A 7: 131,099,300 Y1069* probably null Het
Dopey1 T A 9: 86,521,657 F1637I probably damaging Het
Dusp18 T C 11: 3,897,202 I64T probably damaging Het
Evi5l A G 8: 4,206,491 probably benign Het
Fam212b T A 3: 105,716,614 S82R possibly damaging Het
Fiz1 T C 7: 5,012,850 H47R probably damaging Het
Fndc3b G T 3: 27,643,013 P17T possibly damaging Het
Foxa1 T A 12: 57,542,291 Q381L probably benign Het
Gda A G 19: 21,428,473 probably null Het
Gm10044 T C 14: 7,771,181 noncoding transcript Het
Gm12258 T A 11: 58,858,468 S156R possibly damaging Het
Gm973 A G 1: 59,526,972 R117G probably benign Het
Grwd1 C T 7: 45,830,640 V48I probably damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Itga1 A T 13: 114,992,474 C549* probably null Het
Kmt2c C A 5: 25,294,610 G511C probably damaging Het
Knstrn T C 2: 118,833,963 probably benign Het
Lrp2 T C 2: 69,552,424 Y39C possibly damaging Het
Minos1 T C 4: 139,105,907 probably benign Het
N4bp2 T C 5: 65,808,114 Y1169H probably benign Het
Nbr1 C T 11: 101,564,807 T129I probably benign Het
Olfr178 A T 16: 58,889,806 M138K possibly damaging Het
Olfr671 A C 7: 104,975,982 M1R probably null Het
Olfr843 T C 9: 19,248,743 I219V probably benign Het
Oxct1 T A 15: 4,091,195 F254I probably benign Het
Patj T A 4: 98,454,396 S576T possibly damaging Het
Pdxdc1 A T 16: 13,872,499 C202S probably benign Het
Pet100 A T 8: 3,622,381 I19F probably damaging Het
Pik3r5 T C 11: 68,494,233 Y655H probably damaging Het
Pkhd1 A G 1: 20,081,252 S3807P probably damaging Het
Ptma A G 1: 86,526,927 T8A probably damaging Het
R3hdm1 C A 1: 128,236,672 Q1108K probably benign Het
Rimbp2 T C 5: 128,780,342 D815G probably damaging Het
Scn10a A G 9: 119,694,130 F66L probably benign Het
Selenot T C 3: 58,576,875 probably null Het
Serpinb8 A G 1: 107,598,975 T82A probably benign Het
Serpini2 G A 3: 75,267,988 probably benign Het
Slc1a6 G T 10: 78,795,982 G214V probably benign Het
Slc5a6 C A 5: 31,038,100 A425S probably damaging Het
Smo C A 6: 29,736,124 N38K possibly damaging Het
Smtn A T 11: 3,520,811 C909* probably null Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Stk4 T A 2: 164,099,725 V287E probably benign Het
Tdrd7 A G 4: 46,005,358 D388G possibly damaging Het
Tmem57 T C 4: 134,828,134 I343V probably benign Het
Ttn A T 2: 76,812,308 F13294L probably damaging Het
Ube2j1 T G 4: 33,040,745 F84V probably damaging Het
Ugt3a2 A G 15: 9,370,201 Q477R probably damaging Het
Utf1 T C 7: 139,943,946 S25P probably benign Het
Vmn1r184 A T 7: 26,266,988 H53L probably damaging Het
Vmn2r13 A T 5: 109,191,994 N38K possibly damaging Het
Vps13a C T 19: 16,722,411 D756N probably damaging Het
Vwa1 G T 4: 155,773,238 D34E probably damaging Het
Zfhx2 A C 14: 55,064,317 L2070R probably damaging Het
Zfp984 A G 4: 147,755,905 V163A probably benign Het
Zp3r A T 1: 130,583,471 M325K probably benign Het
Other mutations in Ptpn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Ptpn3 APN 4 57270050 missense possibly damaging 0.95
IGL01090:Ptpn3 APN 4 57240833 missense probably damaging 1.00
IGL01399:Ptpn3 APN 4 57225775 missense probably benign 0.01
IGL01413:Ptpn3 APN 4 57270156 missense probably damaging 0.96
IGL01418:Ptpn3 APN 4 57270156 missense probably damaging 0.96
IGL01806:Ptpn3 APN 4 57254915 critical splice donor site probably null
IGL01933:Ptpn3 APN 4 57197576 missense probably benign 0.00
IGL02087:Ptpn3 APN 4 57222019 missense probably damaging 1.00
IGL02269:Ptpn3 APN 4 57197510 missense possibly damaging 0.72
IGL02413:Ptpn3 APN 4 57205020 missense probably damaging 1.00
IGL03163:Ptpn3 APN 4 57222020 missense probably damaging 1.00
R0179:Ptpn3 UTSW 4 57270118 missense probably benign 0.00
R0240:Ptpn3 UTSW 4 57232374 missense probably benign
R0240:Ptpn3 UTSW 4 57232374 missense probably benign
R0310:Ptpn3 UTSW 4 57204958 missense probably benign 0.00
R0492:Ptpn3 UTSW 4 57194304 missense probably benign
R0631:Ptpn3 UTSW 4 57204921 missense probably damaging 0.99
R0656:Ptpn3 UTSW 4 57270075 missense probably benign 0.41
R1443:Ptpn3 UTSW 4 57225775 missense probably benign 0.01
R1741:Ptpn3 UTSW 4 57254922 missense probably damaging 1.00
R1856:Ptpn3 UTSW 4 57239682 missense probably damaging 1.00
R3753:Ptpn3 UTSW 4 57270144 missense probably damaging 1.00
R4431:Ptpn3 UTSW 4 57235355 missense probably damaging 0.97
R4704:Ptpn3 UTSW 4 57270119 missense possibly damaging 0.79
R4935:Ptpn3 UTSW 4 57197568 missense probably damaging 1.00
R5119:Ptpn3 UTSW 4 57218513 missense possibly damaging 0.93
R5410:Ptpn3 UTSW 4 57205019 missense probably damaging 1.00
R6024:Ptpn3 UTSW 4 57248653 splice site probably null
R6061:Ptpn3 UTSW 4 57248681 missense probably damaging 1.00
R6212:Ptpn3 UTSW 4 57270070 missense probably damaging 1.00
R6213:Ptpn3 UTSW 4 57265012 missense probably damaging 1.00
R6239:Ptpn3 UTSW 4 57249981 missense probably benign
R6444:Ptpn3 UTSW 4 57195730 missense possibly damaging 0.51
R6606:Ptpn3 UTSW 4 57265104 splice site probably null
R6656:Ptpn3 UTSW 4 57205905 missense probably damaging 0.99
R6730:Ptpn3 UTSW 4 57270088 missense probably benign
R7133:Ptpn3 UTSW 4 57225863 missense probably benign 0.30
R7231:Ptpn3 UTSW 4 57245062 missense probably damaging 1.00
R7237:Ptpn3 UTSW 4 57239625 missense probably damaging 1.00
R7368:Ptpn3 UTSW 4 57221993 missense probably damaging 1.00
R7604:Ptpn3 UTSW 4 57240845 missense probably damaging 0.99
R7742:Ptpn3 UTSW 4 57265092 critical splice acceptor site probably null
R8023:Ptpn3 UTSW 4 57248688 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTTCATTCTCCACACAGGCAC -3'
(R):5'- AGTTCTGCCAAGACAGACTC -3'

Sequencing Primer
(F):5'- CTCACAGAGATGGCCACAGG -3'
(R):5'- AAGACAGACTCCCAGTGGTCTG -3'
Posted On2016-10-24