Mutagenetix > Incidental Mutations

Incidental Mutation 'R5554:Adamtsl1'

435273

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl1

Ensembl Gene

ENSMUSG00000066113

Gene Name

ADAMTS-like 1

Synonyms

5930437A14Rik, 6720426B09Rik, punctin-1

MMRRC Submission

043111-MU

Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R5554 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85514172-86428385 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86276945 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 533 (Q533R)

Ref Sequence

ENSEMBL: ENSMUSP00000102796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107177

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107178
AA Change: Q533R

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: Q533R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	362	421	2.05e-2	SMART
TSP1	422	476	3.99e-4	SMART
TSP1	508	567	6.39e-3	SMART
TSP1	593	650	7.86e-3	SMART
TSP1	652	712	3.78e-5	SMART
TSP1	715	772	2.66e-2	SMART
TSP1	774	833	1.62e-4	SMART
IGc2	873	937	4.19e-6	SMART
low complexity region	1123	1142	N/A	INTRINSIC
IGc2	1175	1240	1.31e-7	SMART
IGc2	1282	1351	7.81e-15	SMART
IGc2	1400	1467	2.39e-10	SMART
TSP1	1481	1537	2.12e-1	SMART
TSP1	1540	1599	1.74e-4	SMART
TSP1	1600	1658	8.2e0	SMART
TSP1	1660	1717	1.96e-1	SMART
Pfam:PLAC	1721	1751	1.4e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136418

Predicted Effect

probably benign
Transcript: ENSMUST00000141889
AA Change: Q550R

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: Q550R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART
TSP1	525	584	6.39e-3	SMART
TSP1	610	667	7.86e-3	SMART
TSP1	707	764	2.66e-2	SMART
TSP1	766	825	1.62e-4	SMART
IGc2	865	929	4.19e-6	SMART
low complexity region	1115	1134	N/A	INTRINSIC
IGc2	1167	1232	1.31e-7	SMART
IGc2	1274	1343	7.81e-15	SMART
IGc2	1392	1459	2.39e-10	SMART
TSP1	1473	1529	2.12e-1	SMART
TSP1	1532	1591	1.74e-4	SMART
TSP1	1592	1650	8.2e0	SMART
TSP1	1652	1709	1.96e-1	SMART
Pfam:PLAC	1712	1744	5.6e-12	PFAM

Meta Mutation Damage Score

0.1414

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	C	A	11: 101,413,981	R227L	probably benign	Het
Adgb	C	T	10: 10,340,473	R1524H	probably damaging	Het
Ank2	A	T	3: 126,998,973	N739K	possibly damaging	Het
Ankrd39	C	T	1: 36,541,981	G96R	probably damaging	Het
Anxa10	G	A	8: 62,061,046	P249L	possibly damaging	Het
Banp	G	A	8: 121,991,595	E183K	probably damaging	Het
BC051665	C	G	13: 60,784,621	L83F	probably damaging	Het
Btn1a1	A	T	13: 23,459,125	F385I	possibly damaging	Het
Chchd4	A	T	6: 91,465,017	*140R	probably null	Het
Dcpp2	T	C	17: 23,900,571	Y120H	probably damaging	Het
Dlx2	G	A	2: 71,545,461	R173C	possibly damaging	Het
Dmbt1	C	A	7: 131,099,300	Y1069*	probably null	Het
Dopey1	T	A	9: 86,521,657	F1637I	probably damaging	Het
Dusp18	T	C	11: 3,897,202	I64T	probably damaging	Het
Evi5l	A	G	8: 4,206,491		probably benign	Het
Fam212b	T	A	3: 105,716,614	S82R	possibly damaging	Het
Fiz1	T	C	7: 5,012,850	H47R	probably damaging	Het
Fndc3b	G	T	3: 27,643,013	P17T	possibly damaging	Het
Foxa1	T	A	12: 57,542,291	Q381L	probably benign	Het
Gda	A	G	19: 21,428,473		probably null	Het
Gm10044	T	C	14: 7,771,181		noncoding transcript	Het
Gm12258	T	A	11: 58,858,468	S156R	possibly damaging	Het
Gm973	A	G	1: 59,526,972	R117G	probably benign	Het
Grwd1	C	T	7: 45,830,640	V48I	probably damaging	Het
Ifi209	T	A	1: 173,641,197	S198T	probably benign	Het
Itga1	A	T	13: 114,992,474	C549*	probably null	Het
Kmt2c	C	A	5: 25,294,610	G511C	probably damaging	Het
Knstrn	T	C	2: 118,833,963		probably benign	Het
Lrp2	T	C	2: 69,552,424	Y39C	possibly damaging	Het
Minos1	T	C	4: 139,105,907		probably benign	Het
N4bp2	T	C	5: 65,808,114	Y1169H	probably benign	Het
Nbr1	C	T	11: 101,564,807	T129I	probably benign	Het
Olfr178	A	T	16: 58,889,806	M138K	possibly damaging	Het
Olfr671	A	C	7: 104,975,982	M1R	probably null	Het
Olfr843	T	C	9: 19,248,743	I219V	probably benign	Het
Oxct1	T	A	15: 4,091,195	F254I	probably benign	Het
Patj	T	A	4: 98,454,396	S576T	possibly damaging	Het
Pdxdc1	A	T	16: 13,872,499	C202S	probably benign	Het
Pet100	A	T	8: 3,622,381	I19F	probably damaging	Het
Pik3r5	T	C	11: 68,494,233	Y655H	probably damaging	Het
Pkhd1	A	G	1: 20,081,252	S3807P	probably damaging	Het
Ptma	A	G	1: 86,526,927	T8A	probably damaging	Het
Ptpn3	G	T	4: 57,240,843	N257K	probably damaging	Het
R3hdm1	C	A	1: 128,236,672	Q1108K	probably benign	Het
Rimbp2	T	C	5: 128,780,342	D815G	probably damaging	Het
Scn10a	A	G	9: 119,694,130	F66L	probably benign	Het
Selenot	T	C	3: 58,576,875		probably null	Het
Serpinb8	A	G	1: 107,598,975	T82A	probably benign	Het
Serpini2	G	A	3: 75,267,988		probably benign	Het
Slc1a6	G	T	10: 78,795,982	G214V	probably benign	Het
Slc5a6	C	A	5: 31,038,100	A425S	probably damaging	Het
Smo	C	A	6: 29,736,124	N38K	possibly damaging	Het
Smtn	A	T	11: 3,520,811	C909*	probably null	Het
Sntg2	C	T	12: 30,258,041	R215H	probably benign	Het
Stk4	T	A	2: 164,099,725	V287E	probably benign	Het
Tdrd7	A	G	4: 46,005,358	D388G	possibly damaging	Het
Tmem57	T	C	4: 134,828,134	I343V	probably benign	Het
Ttn	A	T	2: 76,812,308	F13294L	probably damaging	Het
Ube2j1	T	G	4: 33,040,745	F84V	probably damaging	Het
Ugt3a2	A	G	15: 9,370,201	Q477R	probably damaging	Het
Utf1	T	C	7: 139,943,946	S25P	probably benign	Het
Vmn1r184	A	T	7: 26,266,988	H53L	probably damaging	Het
Vmn2r13	A	T	5: 109,191,994	N38K	possibly damaging	Het
Vps13a	C	T	19: 16,722,411	D756N	probably damaging	Het
Vwa1	G	T	4: 155,773,238	D34E	probably damaging	Het
Zfhx2	A	C	14: 55,064,317	L2070R	probably damaging	Het
Zfp984	A	G	4: 147,755,905	V163A	probably benign	Het
Zp3r	A	T	1: 130,583,471	M325K	probably benign	Het

Other mutations in Adamtsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Adamtsl1	APN	4	86385640	missense	probably benign	0.01
IGL00741:Adamtsl1	APN	4	86276948	missense	probably damaging	1.00
IGL00770:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00774:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00826:Adamtsl1	APN	4	86156804	missense	probably damaging	1.00
IGL00938:Adamtsl1	APN	4	86342278	missense	possibly damaging	0.93
IGL01012:Adamtsl1	APN	4	86342189	missense	possibly damaging	0.93
IGL01728:Adamtsl1	APN	4	86110837	missense	probably damaging	1.00
IGL01801:Adamtsl1	APN	4	86199322	missense	probably benign	0.23
IGL01922:Adamtsl1	APN	4	86249902	missense	probably damaging	1.00
IGL02006:Adamtsl1	APN	4	86199345	missense	probably damaging	1.00
IGL02192:Adamtsl1	APN	4	86228016	missense	probably damaging	1.00
IGL02351:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02358:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02373:Adamtsl1	APN	4	86249805	missense	probably damaging	1.00
IGL02660:Adamtsl1	APN	4	86232610	missense	probably damaging	1.00
IGL02964:Adamtsl1	APN	4	86424357	missense	probably damaging	1.00
IGL03233:Adamtsl1	APN	4	86342120	missense	probably damaging	1.00
IGL03297:Adamtsl1	APN	4	86423426	missense	probably damaging	0.98
IGL03326:Adamtsl1	APN	4	86252748	splice site	probably benign
PIT4378001:Adamtsl1	UTSW	4	86199364	missense	possibly damaging	0.93
PIT4418001:Adamtsl1	UTSW	4	86243724	missense	probably damaging	1.00
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0132:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0453:Adamtsl1	UTSW	4	86232615	missense	probably damaging	1.00
R0480:Adamtsl1	UTSW	4	86252818	missense	probably benign	0.08
R0496:Adamtsl1	UTSW	4	86341198	missense	probably damaging	1.00
R0538:Adamtsl1	UTSW	4	86343121	missense	probably benign	0.27
R0547:Adamtsl1	UTSW	4	86356355	missense	probably benign	0.37
R0567:Adamtsl1	UTSW	4	86228016	missense	probably damaging	1.00
R0568:Adamtsl1	UTSW	4	86418552	missense	probably damaging	1.00
R0639:Adamtsl1	UTSW	4	86277143	missense	probably damaging	1.00
R0931:Adamtsl1	UTSW	4	86249847	missense	probably benign	0.05
R1186:Adamtsl1	UTSW	4	86388509	missense	probably benign	0.00
R1387:Adamtsl1	UTSW	4	86374993	splice site	probably benign
R1459:Adamtsl1	UTSW	4	86425865	missense	probably damaging	1.00
R1518:Adamtsl1	UTSW	4	86342603	missense	probably damaging	0.99
R1532:Adamtsl1	UTSW	4	86248065	missense	probably benign	0.02
R1603:Adamtsl1	UTSW	4	86415530	missense	probably benign
R1931:Adamtsl1	UTSW	4	86342411	missense	possibly damaging	0.62
R2086:Adamtsl1	UTSW	4	86228012	missense	probably damaging	1.00
R2221:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2223:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2396:Adamtsl1	UTSW	4	86343119	nonsense	probably null
R2397:Adamtsl1	UTSW	4	86199357	missense	probably damaging	1.00
R2426:Adamtsl1	UTSW	4	86156788	missense	probably benign	0.01
R3121:Adamtsl1	UTSW	4	86337009	missense	probably damaging	1.00
R3715:Adamtsl1	UTSW	4	86216976	missense	probably benign	0.01
R3848:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3849:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3850:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R4194:Adamtsl1	UTSW	4	86054008	intron	probably benign
R4354:Adamtsl1	UTSW	4	86156684	missense	probably damaging	1.00
R4795:Adamtsl1	UTSW	4	86243769	critical splice donor site	probably null
R4830:Adamtsl1	UTSW	4	86356382	missense	probably damaging	0.97
R4874:Adamtsl1	UTSW	4	86342492	missense	possibly damaging	0.94
R4939:Adamtsl1	UTSW	4	86243725	missense	possibly damaging	0.95
R4942:Adamtsl1	UTSW	4	86341214	nonsense	probably null
R4947:Adamtsl1	UTSW	4	85764800	missense	possibly damaging	0.93
R4960:Adamtsl1	UTSW	4	86424173	nonsense	probably null
R4971:Adamtsl1	UTSW	4	86336931	missense	probably damaging	1.00
R5141:Adamtsl1	UTSW	4	86156850	missense	possibly damaging	0.77
R5213:Adamtsl1	UTSW	4	86385628	missense	possibly damaging	0.89
R5237:Adamtsl1	UTSW	4	86385669	critical splice donor site	probably null
R5250:Adamtsl1	UTSW	4	86216945	nonsense	probably null
R5411:Adamtsl1	UTSW	4	86388413	critical splice acceptor site	probably null
R5631:Adamtsl1	UTSW	4	86276923	nonsense	probably null
R5739:Adamtsl1	UTSW	4	86232664	missense	probably damaging	1.00
R5905:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6028:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6044:Adamtsl1	UTSW	4	86212691	missense	probably damaging	1.00
R6261:Adamtsl1	UTSW	4	86336878	missense	probably benign	0.09
R6300:Adamtsl1	UTSW	4	86248017	missense	probably damaging	1.00
R6332:Adamtsl1	UTSW	4	86217011	missense	probably damaging	0.96
R6560:Adamtsl1	UTSW	4	86336893	missense	probably damaging	1.00
R6693:Adamtsl1	UTSW	4	86342886	missense	probably benign	0.27
R6736:Adamtsl1	UTSW	4	86342247	missense	probably damaging	1.00
R6964:Adamtsl1	UTSW	4	86156854	missense	probably damaging	1.00
R7064:Adamtsl1	UTSW	4	86342041	missense	possibly damaging	0.80
R7434:Adamtsl1	UTSW	4	86425878	missense	probably damaging	0.99
R7477:Adamtsl1	UTSW	4	86415651	missense	probably damaging	1.00
R7545:Adamtsl1	UTSW	4	85764855	missense	probably damaging	1.00
R7556:Adamtsl1	UTSW	4	86277121	missense	probably benign	0.19
R7580:Adamtsl1	UTSW	4	86054064	missense	possibly damaging	0.53
R7593:Adamtsl1	UTSW	4	86341213	missense	probably damaging	1.00
R7710:Adamtsl1	UTSW	4	86232573	missense
R7908:Adamtsl1	UTSW	4	86356439	missense	probably benign	0.02
R7934:Adamtsl1	UTSW	4	86243725	missense	probably damaging	1.00
R8056:Adamtsl1	UTSW	4	86342032	missense	possibly damaging	0.76
R8109:Adamtsl1	UTSW	4	86248069	missense
R8143:Adamtsl1	UTSW	4	86342255	missense	possibly damaging	0.71
R8205:Adamtsl1	UTSW	4	86199413	makesense	probably null
R8215:Adamtsl1	UTSW	4	86343145	missense	probably benign	0.45
R8250:Adamtsl1	UTSW	4	86342609	missense	probably damaging	1.00
R8261:Adamtsl1	UTSW	4	86276883	missense	probably damaging	0.99
R8417:Adamtsl1	UTSW	4	86156689	missense	possibly damaging	0.81
R8494:Adamtsl1	UTSW	4	86321984	missense	probably damaging	0.99
R8516:Adamtsl1	UTSW	4	86342543	missense	probably damaging	1.00
R8525:Adamtsl1	UTSW	4	86277010	missense	probably damaging	1.00
Z1176:Adamtsl1	UTSW	4	86342177	missense	probably damaging	0.99
Z1176:Adamtsl1	UTSW	4	86342693	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- GAGCAAGCACATCCTGGTAC -3'
(R):5'- CTTGGTGAAGCCCTCATATTCC -3'

Sequencing Primer
(F):5'- TGGTACAGCTCTGGGCC -3'
(R):5'- AGTCATACAGCTCGTCCAGGTC -3'

Posted On

2016-10-24