Incidental Mutation 'R5554:Fiz1'
ID435284
Institutional Source Beutler Lab
Gene Symbol Fiz1
Ensembl Gene ENSMUSG00000061374
Gene NameFlt3 interacting zinc finger protein 1
Synonyms
MMRRC Submission 043111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5554 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5007059-5014697 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5012850 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 47 (H47R)
Ref Sequence ENSEMBL: ENSMUSP00000146713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077385] [ENSMUST00000086349] [ENSMUST00000165320] [ENSMUST00000167804] [ENSMUST00000207030] [ENSMUST00000207050] [ENSMUST00000207412] [ENSMUST00000207901] [ENSMUST00000207946] [ENSMUST00000208944] [ENSMUST00000209030] [ENSMUST00000209060]
Predicted Effect probably damaging
Transcript: ENSMUST00000077385
AA Change: H47R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076603
Gene: ENSMUSG00000061374
AA Change: H47R

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086349
SMART Domains Protein: ENSMUSP00000083533
Gene: ENSMUSG00000051184

DomainStartEndE-ValueType
AT_hook 29 41 1.53e2 SMART
AT_hook 51 63 1.09e0 SMART
ZnF_C2H2 109 131 1.16e-1 SMART
ZnF_C2H2 137 159 1.56e-2 SMART
ZnF_C2H2 165 187 4.4e-2 SMART
ZnF_C2H2 193 216 7.26e-3 SMART
low complexity region 272 287 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165320
AA Change: H47R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128105
Gene: ENSMUSG00000061374
AA Change: H47R

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167804
AA Change: H47R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126765
Gene: ENSMUSG00000061374
AA Change: H47R

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207030
AA Change: H47R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000207050
Predicted Effect probably benign
Transcript: ENSMUST00000207412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207691
Predicted Effect probably benign
Transcript: ENSMUST00000207901
Predicted Effect probably damaging
Transcript: ENSMUST00000207946
AA Change: H47R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208944
AA Change: H47R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000209030
Predicted Effect probably damaging
Transcript: ENSMUST00000209060
AA Change: H47R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9003 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes zinc finger protein, which interacts with a receptor tyrosine kinase involved in the regulation of hematopoietic and lymphoid cells. This gene product also interacts with a transcription factor that regulates the expression of rod-specific genes in retina. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,413,981 R227L probably benign Het
Adamtsl1 A G 4: 86,276,945 Q533R possibly damaging Het
Adgb C T 10: 10,340,473 R1524H probably damaging Het
Ank2 A T 3: 126,998,973 N739K possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Anxa10 G A 8: 62,061,046 P249L possibly damaging Het
Banp G A 8: 121,991,595 E183K probably damaging Het
BC051665 C G 13: 60,784,621 L83F probably damaging Het
Btn1a1 A T 13: 23,459,125 F385I possibly damaging Het
Chchd4 A T 6: 91,465,017 *140R probably null Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dlx2 G A 2: 71,545,461 R173C possibly damaging Het
Dmbt1 C A 7: 131,099,300 Y1069* probably null Het
Dopey1 T A 9: 86,521,657 F1637I probably damaging Het
Dusp18 T C 11: 3,897,202 I64T probably damaging Het
Evi5l A G 8: 4,206,491 probably benign Het
Fam212b T A 3: 105,716,614 S82R possibly damaging Het
Fndc3b G T 3: 27,643,013 P17T possibly damaging Het
Foxa1 T A 12: 57,542,291 Q381L probably benign Het
Gda A G 19: 21,428,473 probably null Het
Gm10044 T C 14: 7,771,181 noncoding transcript Het
Gm12258 T A 11: 58,858,468 S156R possibly damaging Het
Gm973 A G 1: 59,526,972 R117G probably benign Het
Grwd1 C T 7: 45,830,640 V48I probably damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Itga1 A T 13: 114,992,474 C549* probably null Het
Kmt2c C A 5: 25,294,610 G511C probably damaging Het
Knstrn T C 2: 118,833,963 probably benign Het
Lrp2 T C 2: 69,552,424 Y39C possibly damaging Het
Minos1 T C 4: 139,105,907 probably benign Het
N4bp2 T C 5: 65,808,114 Y1169H probably benign Het
Nbr1 C T 11: 101,564,807 T129I probably benign Het
Olfr178 A T 16: 58,889,806 M138K possibly damaging Het
Olfr671 A C 7: 104,975,982 M1R probably null Het
Olfr843 T C 9: 19,248,743 I219V probably benign Het
Oxct1 T A 15: 4,091,195 F254I probably benign Het
Patj T A 4: 98,454,396 S576T possibly damaging Het
Pdxdc1 A T 16: 13,872,499 C202S probably benign Het
Pet100 A T 8: 3,622,381 I19F probably damaging Het
Pik3r5 T C 11: 68,494,233 Y655H probably damaging Het
Pkhd1 A G 1: 20,081,252 S3807P probably damaging Het
Ptma A G 1: 86,526,927 T8A probably damaging Het
Ptpn3 G T 4: 57,240,843 N257K probably damaging Het
R3hdm1 C A 1: 128,236,672 Q1108K probably benign Het
Rimbp2 T C 5: 128,780,342 D815G probably damaging Het
Scn10a A G 9: 119,694,130 F66L probably benign Het
Selenot T C 3: 58,576,875 probably null Het
Serpinb8 A G 1: 107,598,975 T82A probably benign Het
Serpini2 G A 3: 75,267,988 probably benign Het
Slc1a6 G T 10: 78,795,982 G214V probably benign Het
Slc5a6 C A 5: 31,038,100 A425S probably damaging Het
Smo C A 6: 29,736,124 N38K possibly damaging Het
Smtn A T 11: 3,520,811 C909* probably null Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Stk4 T A 2: 164,099,725 V287E probably benign Het
Tdrd7 A G 4: 46,005,358 D388G possibly damaging Het
Tmem57 T C 4: 134,828,134 I343V probably benign Het
Ttn A T 2: 76,812,308 F13294L probably damaging Het
Ube2j1 T G 4: 33,040,745 F84V probably damaging Het
Ugt3a2 A G 15: 9,370,201 Q477R probably damaging Het
Utf1 T C 7: 139,943,946 S25P probably benign Het
Vmn1r184 A T 7: 26,266,988 H53L probably damaging Het
Vmn2r13 A T 5: 109,191,994 N38K possibly damaging Het
Vps13a C T 19: 16,722,411 D756N probably damaging Het
Vwa1 G T 4: 155,773,238 D34E probably damaging Het
Zfhx2 A C 14: 55,064,317 L2070R probably damaging Het
Zfp984 A G 4: 147,755,905 V163A probably benign Het
Zp3r A T 1: 130,583,471 M325K probably benign Het
Other mutations in Fiz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02606:Fiz1 APN 7 5009159 missense possibly damaging 0.96
R0282:Fiz1 UTSW 7 5009201 missense probably benign 0.33
R0548:Fiz1 UTSW 7 5009168 missense possibly damaging 0.86
R1693:Fiz1 UTSW 7 5008728 missense probably benign
R2054:Fiz1 UTSW 7 5008236 missense probably damaging 1.00
R2151:Fiz1 UTSW 7 5012881 missense possibly damaging 0.60
R2204:Fiz1 UTSW 7 5008686 missense probably benign 0.01
R3427:Fiz1 UTSW 7 5012709 missense probably damaging 1.00
R3615:Fiz1 UTSW 7 5008172 missense probably benign 0.36
R3616:Fiz1 UTSW 7 5008172 missense probably benign 0.36
R4690:Fiz1 UTSW 7 5009168 missense probably benign 0.33
R6340:Fiz1 UTSW 7 5008401 missense possibly damaging 0.94
R6343:Fiz1 UTSW 7 5008401 missense possibly damaging 0.94
R6586:Fiz1 UTSW 7 5008401 missense possibly damaging 0.94
R6587:Fiz1 UTSW 7 5008401 missense possibly damaging 0.94
R7999:Fiz1 UTSW 7 5008998 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCTGAGTGGAATGGAGTC -3'
(R):5'- TTTGTACTCCAGAGAAAGCCCC -3'

Sequencing Primer
(F):5'- CAGTGTCTGAGCCACATGTG -3'
(R):5'- CAAGCCACCTCCGGACCTTC -3'
Posted On2016-10-24