Incidental Mutation 'R0193:Cc2d2a'
ID 43529
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Name coiled-coil and C2 domain containing 2A
Synonyms b2b1035Clo, 5730509K17Rik
MMRRC Submission 038452-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.914) question?
Stock # R0193 (G1)
Quality Score 94
Status Validated (trace)
Chromosome 5
Chromosomal Location 43819715-43898317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43893460 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1419 (S1419P)
Ref Sequence ENSEMBL: ENSMUSP00000114349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
AlphaFold Q8CFW7
Predicted Effect possibly damaging
Transcript: ENSMUST00000048150
AA Change: S1480P

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: S1480P

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125866
AA Change: S1419P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: S1419P

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Meta Mutation Damage Score 0.1317 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.7%
  • 20x: 85.3%
Validation Efficiency 95% (186/196)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,444,005 (GRCm39) S96P probably damaging Het
Akr1c20 A G 13: 4,561,292 (GRCm39) probably benign Het
Atp2a3 G T 11: 72,863,046 (GRCm39) V99L possibly damaging Het
Atp6v0a1 T A 11: 100,939,308 (GRCm39) I691N possibly damaging Het
Atp8b1 C T 18: 64,694,707 (GRCm39) R525Q probably benign Het
Aurkb A G 11: 68,939,370 (GRCm39) D151G probably damaging Het
Bank1 A T 3: 135,772,279 (GRCm39) probably benign Het
Bcl9l T C 9: 44,418,703 (GRCm39) L847P probably damaging Het
Bscl2 T A 19: 8,824,793 (GRCm39) M292K probably benign Het
Cacna1c C T 6: 118,579,363 (GRCm39) probably benign Het
Cadps2 T C 6: 23,599,439 (GRCm39) K260R probably benign Het
Ccdc180 G A 4: 45,914,803 (GRCm39) E145K probably benign Het
Ccno C T 13: 113,125,418 (GRCm39) probably benign Het
Cd300a A G 11: 114,784,202 (GRCm39) D70G probably benign Het
Cenpc1 T C 5: 86,180,262 (GRCm39) D670G probably benign Het
Cenpl A G 1: 160,913,558 (GRCm39) I323V probably damaging Het
Cfap44 A G 16: 44,269,573 (GRCm39) probably null Het
Cfap74 C T 4: 155,510,572 (GRCm39) R386C probably benign Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Clcnkb T C 4: 141,139,627 (GRCm39) E125G possibly damaging Het
Clstn1 G A 4: 149,719,253 (GRCm39) V361M probably damaging Het
Coro7 G A 16: 4,445,368 (GRCm39) probably benign Het
Dchs1 C T 7: 105,414,190 (GRCm39) R875H probably benign Het
Eif3j1 A C 2: 121,882,508 (GRCm39) M239L probably benign Het
Eif4g3 G T 4: 137,873,687 (GRCm39) probably benign Het
Elapor2 A T 5: 9,472,359 (GRCm39) Q352L probably damaging Het
Erbb4 T C 1: 68,083,119 (GRCm39) probably benign Het
Erlin2 T G 8: 27,521,792 (GRCm39) V164G possibly damaging Het
Fbxo43 G T 15: 36,162,029 (GRCm39) Q393K probably benign Het
Fcgr4 A T 1: 170,853,329 (GRCm39) N178I possibly damaging Het
Grid2 A G 6: 64,040,937 (GRCm39) N293S possibly damaging Het
H2-M1 C T 17: 36,982,224 (GRCm39) V126I probably benign Het
Htr1f T A 16: 64,747,112 (GRCm39) Y60F probably damaging Het
Ilf2 A G 3: 90,388,646 (GRCm39) probably null Het
Impg2 A T 16: 56,085,412 (GRCm39) K931* probably null Het
Ints1 T C 5: 139,737,485 (GRCm39) E2176G probably damaging Het
Iqsec2 T C X: 151,006,399 (GRCm39) V1319A probably benign Het
Iqsec3 G T 6: 121,387,683 (GRCm39) D685E probably damaging Het
Itgbl1 G A 14: 124,083,958 (GRCm39) V279I probably benign Het
Kdm4b C T 17: 56,700,952 (GRCm39) A541V probably benign Het
Kif14 A T 1: 136,396,176 (GRCm39) T161S probably benign Het
Krt86 T C 15: 101,377,244 (GRCm39) probably benign Het
Kyat1 C T 2: 30,077,198 (GRCm39) probably null Het
Limch1 T C 5: 67,184,882 (GRCm39) W791R probably damaging Het
Map3k11 T A 19: 5,745,874 (GRCm39) M396K probably damaging Het
Mat2a A G 6: 72,413,178 (GRCm39) probably null Het
Mbnl2 A G 14: 120,616,649 (GRCm39) I88V possibly damaging Het
Mib2 T C 4: 155,740,130 (GRCm39) T708A probably benign Het
Mix23 T C 16: 35,903,184 (GRCm39) S59P probably damaging Het
Mkks T C 2: 136,719,526 (GRCm39) probably null Het
Mtss1 T C 15: 58,815,866 (GRCm39) M565V probably damaging Het
Myoc A G 1: 162,476,604 (GRCm39) N436S probably damaging Het
Myod1 T A 7: 46,026,536 (GRCm39) V147E probably damaging Het
Ngef A G 1: 87,437,056 (GRCm39) L144P probably benign Het
Ngrn C T 7: 79,911,678 (GRCm39) R92W probably damaging Het
Nup153 G A 13: 46,863,130 (GRCm39) T349I probably benign Het
Or4c15 T A 2: 88,760,627 (GRCm39) I11L probably benign Het
Or52ad1 G T 7: 102,995,411 (GRCm39) S241R possibly damaging Het
Pigl A G 11: 62,394,574 (GRCm39) I135M probably damaging Het
Pitpnm3 A G 11: 71,961,318 (GRCm39) probably benign Het
Pkhd1 A T 1: 20,429,141 (GRCm39) F2420I probably damaging Het
Polr2b C T 5: 77,467,923 (GRCm39) T119M probably damaging Het
Prr29 A G 11: 106,267,722 (GRCm39) Y130C probably damaging Het
Rab11fip3 T C 17: 26,209,973 (GRCm39) I1048V probably damaging Het
Rab12 G A 17: 66,807,357 (GRCm39) T124I probably damaging Het
Rab44 A G 17: 29,359,281 (GRCm39) S490G probably benign Het
Rasa3 A G 8: 13,620,233 (GRCm39) probably null Het
Rhbdl3 C T 11: 80,244,400 (GRCm39) S369L possibly damaging Het
Rimbp2 A T 5: 128,865,420 (GRCm39) S643T probably benign Het
Rin1 T G 19: 5,102,680 (GRCm39) S396R probably damaging Het
Rpusd3 C T 6: 113,396,198 (GRCm39) G28S probably damaging Het
Rtl9 T A X: 141,883,274 (GRCm39) S229T probably damaging Het
Rufy1 G T 11: 50,280,679 (GRCm39) T701N probably benign Het
Scn4a A T 11: 106,211,364 (GRCm39) L1551* probably null Het
Sec24b T C 3: 129,782,633 (GRCm39) N1119S probably null Het
Serbp1 T A 6: 67,249,868 (GRCm39) *75R probably null Het
Setx C T 2: 29,069,685 (GRCm39) P2497S probably benign Het
Slc26a11 A T 11: 119,250,140 (GRCm39) I132F probably damaging Het
Slc4a1 A G 11: 102,243,510 (GRCm39) V707A possibly damaging Het
Slfn1 A G 11: 83,012,669 (GRCm39) I262V probably damaging Het
Tmem168 T A 6: 13,583,312 (GRCm39) D523V possibly damaging Het
Traf7 G T 17: 24,729,525 (GRCm39) Q469K probably benign Het
Trdmt1 C A 2: 13,549,428 (GRCm39) V6F probably damaging Het
Tsacc A T 3: 88,194,395 (GRCm39) probably benign Het
Vmn2r5 A G 3: 64,398,951 (GRCm39) I589T possibly damaging Het
Vmn2r7 T C 3: 64,598,460 (GRCm39) D699G probably damaging Het
Vmn2r82 T C 10: 79,217,129 (GRCm39) V487A probably damaging Het
Zbtb47 T C 9: 121,596,732 (GRCm39) V696A probably damaging Het
Zfp287 A T 11: 62,605,855 (GRCm39) S351T probably benign Het
Zfp654 T C 16: 64,606,051 (GRCm39) H176R possibly damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43,881,722 (GRCm39) splice site probably benign
IGL00937:Cc2d2a APN 5 43,845,464 (GRCm39) critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43,846,345 (GRCm39) missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43,881,126 (GRCm39) missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43,841,527 (GRCm39) missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43,846,311 (GRCm39) missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43,845,579 (GRCm39) missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43,840,457 (GRCm39) missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43,842,590 (GRCm39) splice site probably null
IGL02364:Cc2d2a APN 5 43,892,792 (GRCm39) missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43,840,547 (GRCm39) splice site probably benign
IGL02458:Cc2d2a APN 5 43,875,896 (GRCm39) missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43,846,252 (GRCm39) splice site probably benign
IGL02834:Cc2d2a APN 5 43,871,863 (GRCm39) nonsense probably null
IGL02940:Cc2d2a APN 5 43,885,636 (GRCm39) splice site probably null
IGL03003:Cc2d2a APN 5 43,828,608 (GRCm39) missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43,889,721 (GRCm39) missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43,892,799 (GRCm39) splice site probably benign
P0028:Cc2d2a UTSW 5 43,841,541 (GRCm39) missense probably benign
R0201:Cc2d2a UTSW 5 43,894,854 (GRCm39) missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43,845,608 (GRCm39) splice site probably null
R0243:Cc2d2a UTSW 5 43,853,980 (GRCm39) splice site probably benign
R0317:Cc2d2a UTSW 5 43,864,243 (GRCm39) critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43,860,636 (GRCm39) missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43,881,729 (GRCm39) splice site probably benign
R0624:Cc2d2a UTSW 5 43,887,371 (GRCm39) missense probably benign
R0634:Cc2d2a UTSW 5 43,838,723 (GRCm39) splice site probably benign
R1503:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43,879,812 (GRCm39) missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43,896,713 (GRCm39) missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43,881,030 (GRCm39) splice site probably null
R1715:Cc2d2a UTSW 5 43,876,003 (GRCm39) missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43,871,873 (GRCm39) missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43,845,594 (GRCm39) missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43,898,170 (GRCm39) missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43,863,564 (GRCm39) missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43,883,715 (GRCm39) critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43,841,375 (GRCm39) splice site probably benign
R2244:Cc2d2a UTSW 5 43,889,775 (GRCm39) missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43,861,230 (GRCm39) missense probably benign
R2442:Cc2d2a UTSW 5 43,828,647 (GRCm39) critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43,892,737 (GRCm39) missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43,842,593 (GRCm39) splice site probably null
R3147:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43,893,451 (GRCm39) missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43,876,056 (GRCm39) missense probably benign
R3870:Cc2d2a UTSW 5 43,876,033 (GRCm39) nonsense probably null
R4334:Cc2d2a UTSW 5 43,840,476 (GRCm39) missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43,896,665 (GRCm39) missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43,845,563 (GRCm39) missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43,877,775 (GRCm39) missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43,863,555 (GRCm39) missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43,887,383 (GRCm39) missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43,852,518 (GRCm39) missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43,866,433 (GRCm39) missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43,887,249 (GRCm39) missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43,879,804 (GRCm39) missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43,869,760 (GRCm39) missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43,873,117 (GRCm39) missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43,869,768 (GRCm39) missense probably benign
R5912:Cc2d2a UTSW 5 43,877,772 (GRCm39) missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43,887,317 (GRCm39) missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43,826,015 (GRCm39) missense probably benign
R6142:Cc2d2a UTSW 5 43,860,540 (GRCm39) missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43,828,577 (GRCm39) missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43,873,118 (GRCm39) missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43,861,416 (GRCm39) missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43,896,754 (GRCm39) missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43,876,019 (GRCm39) missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43,838,673 (GRCm39) missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43,860,557 (GRCm39) missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43,875,927 (GRCm39) missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43,891,271 (GRCm39) missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43,857,321 (GRCm39) nonsense probably null
R7071:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43,840,481 (GRCm39) missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43,887,332 (GRCm39) missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43,864,188 (GRCm39) missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43,896,651 (GRCm39) missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43,852,638 (GRCm39) critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43,863,442 (GRCm39) missense possibly damaging 0.71
R8117:Cc2d2a UTSW 5 43,869,781 (GRCm39) missense probably damaging 1.00
R8123:Cc2d2a UTSW 5 43,867,896 (GRCm39) missense probably benign
R8179:Cc2d2a UTSW 5 43,857,295 (GRCm39) missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43,893,487 (GRCm39) missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43,845,570 (GRCm39) missense probably damaging 0.97
R8480:Cc2d2a UTSW 5 43,842,486 (GRCm39) splice site probably null
R8482:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R8731:Cc2d2a UTSW 5 43,892,788 (GRCm39) missense probably damaging 1.00
R8780:Cc2d2a UTSW 5 43,896,692 (GRCm39) missense probably damaging 1.00
R8784:Cc2d2a UTSW 5 43,860,645 (GRCm39) missense possibly damaging 0.90
R8871:Cc2d2a UTSW 5 43,857,285 (GRCm39) missense possibly damaging 0.71
R8972:Cc2d2a UTSW 5 43,867,884 (GRCm39) missense probably benign
R9122:Cc2d2a UTSW 5 43,831,081 (GRCm39) missense probably null 0.07
R9125:Cc2d2a UTSW 5 43,860,563 (GRCm39) missense probably benign
R9203:Cc2d2a UTSW 5 43,891,179 (GRCm39) missense probably benign 0.01
R9310:Cc2d2a UTSW 5 43,852,488 (GRCm39) missense probably damaging 1.00
R9343:Cc2d2a UTSW 5 43,875,999 (GRCm39) missense probably damaging 1.00
R9353:Cc2d2a UTSW 5 43,860,691 (GRCm39) critical splice donor site probably null
Z1177:Cc2d2a UTSW 5 43,860,546 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTGTGTGAATCTTTGCCTAATTCTC -3'
(R):5'- AGGTTGCACCTGTAGTTTGATTTCATCC -3'

Sequencing Primer
(F):5'- GAATCTTTGCCTAATTCTCTGCCTC -3'
(R):5'- TGTAGTTTGATTTCATCCTTCACAG -3'
Posted On 2013-05-24